LncRNA-CR11538 functions as a decoy of Dif/Dorsal to negatively regulate Drosophila Toll immune responses
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA753783 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR15414744_1.fastq.gz | Fastqsanger.gz | |||
| SRR15414744_2.fastq.gz | Fastqsanger.gz | |||
| SRR15414745_1.fastq.gz | Fastqsanger.gz | |||
| SRR15414745_2.fastq.gz | Fastqsanger.gz | |||
| SRR15414746_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:The maintenance of innate immune homeostasis is critical for animal survival to combat pathogens. Although many positive or negative protein factors have been identified, little is known about the long non-coding RNA that regulates the Toll pathway. Herein, we have discovered a novel lncRNA-CR11538 highly activated during the Drosophila response to gram+ bacterial infection. The transient overexpression of CR11538 inhibited the expression of antimicrobial peptides (Drosomycin and Metchnikowin) in vivo to suppress Toll signaling pathway. Remarkably, core enrichment genes based on RNAseq, subcellular localization and RIP suggest that CR11538 can interact with the transcription factor Dif/Dorsal in nucleus. ChIP-qPCR and dual luciferase report experiments show that CR11538 can sequester Dif/Dorsal away from the promoter thus suppressing the transcription of antimicrobial peptides. In summary, we discovered a novel lncRNA-CR11538 that negatively regulate the Drosophila Toll pathway. It broadens our understanding of the regulatory mechanism of Toll pathway involving lncRNA and provides insights for the research on innate immune system of insects and mammals.
2021-08-13 | GSE181870 | GEO
Project description:LncRNAs have important regulatory functions but their roles in Drosophila innate immunity are poorly understood. The Drosophila Toll signaling pathway responds to Gram-positive bacterial infection and is highly conserved with mammalian TLR signaling. Recent studies focused mainly on Toll signaling pathway regulation by protein-coding genes. In the present study, we found that lncRNA-CR33942 was upregulated after Micrococcus luteus infection. Gain-of-function and loss-of-function assays disclosed that lncRNA-CR33942 regulates the Toll signaling pathway and affects Drosophila survival. RNA-seq of infected CR33942-overexpressing flies was performed to explore the CR33942 mechanism. About 70% of all upregulated core enrichment genes in the Toll signaling pathway were antibacterial peptides and PGRPs transcribed by Dif/Dorsal. We also demonstrated CR33942 interactions with Dif/Dorsal and revealed that they induce antibacterial peptides. Hence, we renamed CR33942 as lncRNA-NANPI (NF-κB-associated non-coding RNA promotional immunology). The present study identified the novel Toll signaling pathway regulator NANPI, elucidated its mode of action, clarified the function of lncRNA, and expanded our understanding of the Toll signaling pathway.
2021-05-07 | GSE174007 | GEO
Project description:The Toll signaling pathway is highly conserved from insects to mammals. Drosophila is a model species that is commonly used to study innate immunity. Although many studies have assessed protein-coding genes that regulate the Toll pathway, it is unclear whether long noncoding RNAs (lncRNAs) play regulatory roles in the Toll pathway. Here, we evaluated the expression of the lncRNA CR46018 in Drosophila. Our results showed that this lncRNA was significantly overexpressed after infection of Drosophila with Micrococcus luteus. A CR46018-overexpressing Drosophila strain was then constructed; we expected that CR46018 overexpression would enhance the expression of various antimicrobial peptides downstream of the Toll pathway, regardless of infection with M. luteus. RNA-seq analysis of CR46018-overexpressing Drosophila after infection with M. luteus showed that upregulated genes were mainly enriched in Toll and Imd signaling pathways. Moreover, bioinformatics predictions and RNA-immunoprecipitation experiments showed that CR46018 interacted with the transcription factors Dif and Dorsal to enhance the Toll pathway. During gram-positive bacterial infection, flies overexpressing CR46018 showed favorable survival compared with flies in the control group. Based on these findings, we renamed CR46018 as lncRNA-RDIP. Overall, our current work not only reveals a new immune regulatory factor, lncRNA-RDIP, and explores its potential regulatory model, but also provides a new perspective for the effect of immune disorders on the survival of Drosophila melanogaster.
2021-05-20 | GSE174684 | GEO
Project description:lncRNA-CR46018 as a positive regulator controls Drosophila Toll immune response by interacting with Dif/Dorsal
| PRJNA731115 | ENA
Project description:Drosophila lncRNA-NANPI enhances Toll signaling pathway by interacting with Dif/Dorsal to facilitate transcription of antibacterial peptides
| PRJNA727845 | ENA
Project description:This study explores the effect of ectopic expression of Dorsal and Dif on Drosophila larval gene expression. The abstract of the manuscript we are submitting follows: Microarray analyses reveal possible new targets for the Rel protein Dif in Drosophila melanogaster The fruit fly Drosophila melanogaster express three closely related NF-κB-like transcription factors: Dorsal, Dif, and Relish. They share significant sequence identity in their DNA binding Rel homology domain and bind similar DNA sequence motifs. These factors play an important role in the transcription of Drosophila humoral immune proteins such as antimicrobial peptides during infection. To study their roles in vivo, we used microarrays to determine the effect of null mutations in individual Rel transcription factors on larval gene expression. Of the 188 genes that were significantly upregulated in wildtype larvae upon bacterial challenge, overlapping but distinct groups of genes were affected in the Rel mutants. We also ectopically expressed Dorsal or Dif and used cDNA microarrays to determine the genes that were up-regulated in the presence of these transcription factors. Combining this data, we identified novel genes that may be specific targets of Dif. Keywords: Genetic Modification
2007-04-16 | GSE5469 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:The abstract of the manuscript titled "Microarray analyses reveal possible new targets for the Rel protein Dif in Drosophila melanogaster " is given below: The fruit fly Drosophila melanogaster express three closely related NF-κB-like transcription factors: Dorsal, Dif, and Relish. They share significant sequence identity in their DNA binding Rel homology domain and bind similar DNA sequence motifs. These factors play an important role in the transcription of Drosophila humoral immune proteins such as antimicrobial peptides during infection. To study their roles in vivo, we used microarrays to determine the effect of null mutations in individual Rel transcription factors on larval gene expression. Of the 188 genes that were significantly upregulated in wildtype larvae upon bacterial challenge, overlapping but distinct groups of genes were affected in the Rel mutants. We also ectopically expressed Dorsal or Dif and used cDNA microarrays to determine the genes that were up-regulated in the presence of these transcription factors. Combining this data, we identified novel genes that may be specific targets of Dif. Keywords: genetic modification
2007-04-16 | GSE5489 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:The abstract of the manuscript titled "Microarray analyses reveal possible new targets for the Rel protein Dif in Drosophila melanogaster " is given below: ; The fruit fly Drosophila melanogaster express three closely related NF-κB-like transcription factors: Dorsal, Dif, and Relish. They share significant sequence identity in their DNA binding Rel homology domain and bind similar DNA sequence motifs. These factors play an important role in the transcription of Drosophila humoral immune proteins such as antimicrobial peptides during infection. To study their roles in vivo, we used microarrays to determine the effect of null mutations in individual Rel transcription factors on larval gene expression. Of the 188 genes that were significantly upregulated in wildtype larvae upon bacterial challenge, overlapping but distinct groups of genes were affected in the Rel mutants. We also ectopically expressed Dorsal or Dif and used cDNA microarrays to determine the genes that were up-regulated in the presence of these transcription factors. Combining this data, we identified novel genes that may be specific targets of Dif. Experiment Overall Design: This study uses Affymetrix chips to study the effect on gene expression when third instar larvae are injected with PBS or E. coli bacteria. Wildtype, Dorsal1 mutant, Dif1 mutant, and Relish E20 mutant larvae are used to determine the effect of the mutations on gene expression.
2008-06-13 | E-GEOD-5489 | biostudies-arrayexpress