Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: soil 16S rRNA high-throughput sequencing

PROVIDER: PRJNA776560 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR16643489_1.fastq.gz	Fastqsanger.gz
	SRR16643489_2.fastq.gz	Fastqsanger.gz
	SRR16643490.fastq.gz	Fastqsanger.gz
	SRR16643490_1.fastq.gz	Fastqsanger.gz
	SRR16643490_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 8

Similar Datasets

Project description:high-throughput sequencing soil 16S rRNA gene

| PRJNA800347 | ENA

Microbial diversity of an uncontaminated and a 2,4,6-TNT contaminated soil sample with CodeLink microarrays

Project description:Comparison of probe-target dissociations of probe Eub338 and Gam42a with native RNA of P. putida, in vitro transcribed 16s rRNA of P. putida, in vitro transcribed 16S rRNA of a 2,4,6-trinitrotoluene contaminated soil and an uncontaminated soil sample. Functional ANOVA revealed no significant differences in the dissociation curves of probe Eub338 when hybridised to the different samples. On the opposite, the dissociation curve of probe Gam42a with native RNA of P. putida was significantly different than the dissociation curves obtained with in vitro transcribed 16S rRNA samples. Keywords: Microbial diversity, thermal dissociation analysis, CodeLink microarray

2005-11-05 | GSE3525 | GEO

Nobiletin ameliorates high fat-induced disruptions in rhythmic glucagon-like peptide-1 secretion - 16S

Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.

2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress

A phylogenetic microarray targeting 16S rRNA genes from the bacterial division Acidobacteria

Project description:Investigation of the phylogenetic diversity of Acidobacteria taxa using PCR amplicons from positive control 16S rRNA templates and total genomic DNA extracted from soil and a soil clay fraction A ten chip study using PCR amplicons from cloned 16S rRNA genes and from diverse soil 16S rRNAs, with PCR primers specific to the Division Acidobacteria. Each chip measures the signal from 42,194 probes (in triplicate) targeting Acidobacteria division, subdivision, and subclades as well as other bacterial phyla. All samples except one (GSM464591) include 2.5 M betaine in the hybridization buffer. Pair files lost due to a computer crash.

2010-06-24 | E-GEOD-18711 | biostudies-arrayexpress

A phylogenetic microarray targeting 16S rRNA genes from the bacterial division Acidobacteria

2010-01-01 | GSE18711 | GEO

Project description:High-throughput sequencing of soil 16S rRNA amplicons

| PRJNA909080 | ENA

Project description:16s rRNA high-throughput sequencing

| PRJNA794205 | ENA

Project description:16S rRNA High-Throughput Sequencing

| PRJNA464196 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:High-throughput sequencing of 16S rRNA

| PRJNA903654 | ENA