Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq of HNRNPAB morpholino in zebrafish

ABSTRACT: RNA-seq of HNRNPAB morpholino in zebrafish

PROVIDER: PRJNA820769 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR18505678_1.fastq.gz	Fastqsanger.gz
	SRR18505678_2.fastq.gz	Fastqsanger.gz
	SRR18505679_1.fastq.gz	Fastqsanger.gz
	SRR18505679_2.fastq.gz	Fastqsanger.gz
	SRR18505680_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 6

Similar Datasets

RNA-seq of HNRNPAB morpholino in zebrafish

Project description:To investigate the transcriptomic alterations following 24hpf knockdown of the gene HNRNPAB in zebrafish, we injected HNRNPAB morpholino with 3ng and 6ng into 1-cell zebrafish embryos separately, and the 24hpf embryos were collected for RNA-seq.

2022-03-31 | GSE199586 | GEO

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Transcription profiling of zebrafish embryos injected with DrC1q-like morpholino and control morpholino

Project description:Except complement C1q, the immunological functions of other C1q family members have remained unclear. In vitro studies showed that DrC1q-like could inhibit the apoptosis induced by ActD and CHX in EPC cells, through repressing the activation of caspase 3/9. Moreover, its physiological roles were studied by morpholino-mediated knockdown in zebrafish embryogenesis; We used microarrays to compare the global programme of gene expression of DrC1q-like deficient embryos and control embryos. And identified distinct classes of up-regulated and down-regulated genes in DrC1q-like deficient embryos. Experiment Overall Design: Zebrafish embryos were selected at 24hpf for RNA extraction and hybridization on Affymetrix microarrays. We sought to obtain expression profiles of DrC1q-like deficient embryos compared to the control. And we could find out which genes and pathways were affected by DrC1q-like

2008-06-16 | E-GEOD-8800 | biostudies-arrayexpress

Transcription profiling of zebrafish embryos with dpf3 knocked down for morpholino

Project description:An experiment was performed to analyze the effect of knockdown of dpf3 during zebrafish embryogenesis.Morpholino against dpf3 and control morpholino were injected into eggs and eggs were kept under standard conditions for 72 hours. Embroys were harvested, total RNA was extracted and used for microarray analysis.

2008-08-01 | E-TABM-354 | biostudies-arrayexpress

Transcription profiling of zebrafish embryos injected with a morpholino targeting LIN9

Project description:TÜAB zebrafish were maintained at 28.5 °C in in 1x Danieau solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca (NO3)2, 5 mM HEPES, pH 7.6, 0.0001 % Methylene blue). Morpholinos (Gene Tools, Philomath, OR) were designed against Danio rerio lin-9 homolog (Genebank accession NM_001044946). The morpholino (MO) sequences were MO-E1 5´-GTTAGTTTTATTACTCACTCTCGTC-3´ and 5-base mismatch morpholino MO-E1mis 5´-GTTACTTTTAATACTGACTGTCCTC-3´. 7 ng of morpholinos were injected into one cell-stage embryos. 20 embryos per condition (MO E1; MO E1mis) were pooled for RNA purification 24 h post fertilization. Using the two color Quick-Amp Labeling Kit (Agilent; 5190-0444) 100 ng of total RNA were used for cDNA synthesis, mRNA amplification and labeling according to manufacturers instructions. Transcriptional profiling was done on a zebrafish oligo array (Agilent; G2519F AMADID 019161) in a 4 x 44K slide format and analyzed as described before.<br>

2009-03-28 | E-MEXP-2100 | biostudies-arrayexpress

RNA-seq of the anterior third (head) region of fifty pooled danio rerio embryos at the 15-somite stage following crispld2 morpholino knockdown compared to uninjected controls

Project description:We have a well characterized crispld2 morpholino in the danio rerio organism system. The aim of this experiment was to determine differential gene expression in the morpholino zebrafish compared to uninjected zebrafish.

2018-05-13 | E-MTAB-6705 | biostudies-arrayexpress

RNA-seq of zebrafish primordial germ cells and somatic cells during early embryogenesis

Project description:Zebrafish Primordial Germ Cells (PGCs) were tracked in the Tg(Buc-GFP) line where the germ plasm protein Buc is fused to GFP. GFP-positive cells were isolated via FACS and RNA-seq was performed on polyadenylated transcripts for PGCs and somatic cells at 256-cell, high, dome, 10 somites and prim-5 stages. Two hundred cells were used for each biological replicate. RNA-seq was also performed on embryos in where Tdrd7 translation was inhibited via morpholino treatment.

2020-12-24 | E-MTAB-8707 | biostudies-arrayexpress

Zebrafish Retina thrb-/- RNA-seq

Project description:Zebrafish Retina thrb-/- RNA-seq

| PRJNA599983 | ENA

RNA-Seq Analysis

Project description:RNA-Seq analysis carried out in three different backcrosses based on Iberian breed with Landrace, Pietrain and Duroc breeds

2017-10-31 | PRJEB23068 | EVA

Transcriptional profiling of embryonic zebrafish expressing a mutant TNNT2

Project description:Transcriptional profiling of embryonic zebrafish injected with a control morpholino or a morpholino that causes exclusion of TNNT2 exon 13. Zebrafish embryos were injected with a antisense morpholino oligo that induced missplicing of exon 13 of TNNT2 (TNNT2sp) or a control morpholino. At 96hpf these embryos were euthanized and RNA was collected.

2010-12-31 | E-GEOD-20179 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data