Ontology highlight
ABSTRACT:
PROVIDER: PRJNA835479 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR19100867_1.fastq.gz | Fastqsanger.gz | |||
| SRR19100867_2.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 2 of 2 |
Similar Datasets
Project description:CRISPR screen in NIH-3T3 cells using sgRNA library for gRNA enrichment analysis
| PRJEB71335 | ENA
Project description:A whole genome screen using a CRISPR lentivirus library (Doench et al., 2016) was performed. The Brunello CRISPR library consists of a pool of 76,441 human targeting guide RNAs (gRNA) and 1000 control gRNAs [non-targeting (NT) or intergenic], in a lentiviral vector that expresses Cas9. The pooled library targets 19,114 human genes, most of them by four gRNA per gene. To avoid multiple different gRNA in cells and a nonspecific effect on the screen results (Doench, 2018), a low infection lentivirus titer (multiplicity of infection that is <1) was used. Library transduced cells (LT SC-islets) were allowed at least 10 days for CRISPR editing, before transplantation to the NSG-MHCnull mouse model, where PBMCs were injected to half of the cohort (hPi mice: n=6, control mice: n=6) (Figures 3A). hPi mice retained levels of circulating T cells throughout the experiment (Figures S3A and S3B). Graft function and subsequent failure due to human PBMC injection was assessed (Figures 3B and S3C). When hPi graft failure was confirmed, 10 weeks after PBMC injection (Figure 3B), both control and hPi grafts were recovered from kidney sites, genomic DNA (gDNA) was extracted, and gRNA regions were amplified by PCR for Illumina sequencing.
2022-09-01 | GSE200085 | GEO
Project description:We present GuideScan2 for memory-efficient, parallelizable construction of high-specificity CRISPR guide RNA (gRNA) databases and user-friendly design and analysis of individual gRNAs and gRNA libraries for targeting coding and non-coding regions in custom genomes. GuideScan2 analysis identifies widespread confounding effects of low-specificity gRNAs in published CRISPR screens and enables construction of a gRNA library that reduces off-target effects in a gene essentiality screen. GuideScan2 also enables the design and experimental validation of allele-specific gRNAs in a hybrid mouse genome. GuideScan2 will facilitate CRISPR experiments across a wide range of applications.
2025-01-08 | GSE285667 | GEO
Project description:Immortalised HaCaT keratinocytes were transduced with Cas9 and the CRISPR-KO v1.1 genome-wide gRNA library. The gRNA library was prepared from genomic DNA isolated 14 days post library transduction. gRNA representation will be compared to the original CRISPR-KO v1.1 library to reveal genes essential for HaCaT survival and growth.
| EGAS00001002714 | EGA
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Organoids were generated from cells infected with pooled lentivirus library. The lentiviral libraries deliver dual-gRNAs targeting 36 high-risk ASD genes in parallel. With or without 4-OHT induction of eCas9 expression, organoids were dissociated at specific developmental stages. Single cells were sorted and bulk genomic DNA was extracted. Target amplification was performed using genomic DNA to analyze gRNA and unique clone barcode representation.
2023-07-09 | E-MTAB-13140 | biostudies-arrayexpress
Project description:Genome-wide CRISPR-Cas9 knockout screen using TKOv1 sgRNA library performed in isogenic RBM10-proficient and RBM10-deficient HCC827 cells.
2024-03-01 | E-MTAB-13626 | biostudies-arrayexpress