Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Steroid-resistant nephrotic syndrome associated MYO1E mutations have differential effects on myosin 1e localization, dynamics, and activity

ABSTRACT: Steroid-resistant nephrotic syndrome associated MYO1E mutations have differential effects on myosin 1e localization, dynamics, and activity

PROVIDER: PRJNA836940 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR19159412.fastq.gz	Fastqsanger.gz
	SRR19159413.fastq.gz	Fastqsanger.gz
	SRR19159414.fastq.gz	Fastqsanger.gz
	SRR19159415.fastq.gz	Fastqsanger.gz
	SRR19159416.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 6

Similar Datasets

Steroid-resistant nephrotic syndrome associated MYO1E mutations have differential effects on myosin 1e localization, dynamics, and activity

Project description:Patients deficient in myosin 1e and mice in which Myo1e is knocked out develop Focal Segmental Glomerlosclerosis. To study the impact of myo1e deficiency on cultured podocytes, we derived conditionally immortalized glomerular epithelial cells from crosses between the Myo1e-KO mice and a H-2Kb-tsA58 mice (Immortomouse) to obtain Myo1e- heterozygous and Myo1e-KO podocyte-derived cells. The purpose of this study was to analyze the transcriptome differences between wild-type Murine Podocyte Cells (MPC) originally described in PMID 9344605 and mantained in our lab for several passages, Myo1e Heterozygous cells, and Myo1e KO cells. RNAseq and differential gene expression analysis was performed.

2022-08-24 | GSE202684 | GEO

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

Transcriptome profile of leukocyte RNA from children with steroid sensitive and resistant nephrotic syndrome

Project description:Glucocorticoid resistance complicates the treatment of ~20% of children with nephrotic syndrome, yet the molecular basis for resistance remains unclear. We generated the transcriptome profile by RNA sequencing of peripheral blood leukocytes from children obtained both at initial nephrotic syndrome presentation and after ~7 weeks of glucocorticoid therapy to identify genes or a gene panel able to differentiate steroid sensitive from steroid resistant nephrotic syndrome. RNA -seq analysis was followed by in-silico algorithm-based approaches and subsequent biochemical analyses on relevant candidate gene with important roles in podocyte and glomerular pathophysiology, using both patient samples and experimental models of nephrotic syndrome and podocyte injury.

2021-02-16 | GSE145969 | GEO

Pilot Plasma Proteomic Study of Steroid Resistance in Pediatric Nephrotic Syndrome

Project description:Pilot proteomic study of immunodepleted plasma samples comparing steroid sensitive and steroid resistant pediatric nephrotic syndrome patients.

2018-02-27 | MSV000082114 | MassIVE

Urinary sediment mRNA level of CREBBP and CYBA in children with steroid-resistant nephrotic syndrome

Project description:This study aimed to evaluate gene expression patterns in urinary sediment samples of children with steroid-resistant nephrotic syndrome (SRNS).

2022-02-23 | GSE189734 | GEO

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

| PRJNA836939 | ENA

Predicting and Defining Steroid Resistance in Pediatric Nephrotic Syndrome using Plasma Metabolomics

Project description:Paired citrate plasma samples were collected from 27 steroid-sensitive and 14 steroid-resistant nephrotic syndrome participants prior to beginning treatment and after an average of 7 weeks (range 3-19 wks) of treatment with a corticosteroid.

2018-03-01 | ST000939 | MetabolomicsWorkbench

Transcriptome profile of leukocyte RNA from children with steroid sensitive and resistant nephrotic syndrome

Project description:Transcriptome profile of leukocyte RNA from children with steroid sensitive and resistant nephrotic syndrome

| PRJNA608900 | ENA

Urinary sediment mRNA level of CREBBP and CYBA in children with steroid-resistant nephrotic syndrome

Project description:Urinary sediment mRNA level of CREBBP and CYBA in children with steroid-resistant nephrotic syndrome

| PRJNA784291 | ENA

Caldendrin regulates spine apparatus localization through myosin V-dependent ER-stabilization in dendritic spines

Project description:Excitatory synapses of principal hippocampal neurons are frequently located on dendritic spines. The dynamic strengthening or weakening of individual inputs results in a great structural and molecular diversity of dendritic spines. Active spines with large Ca2+-transients are frequently invaded by a single protrusion from the endoplasmic reticulum (ER), which is dynamically transported into spines by the actin-based motor myosin V. An increase in synaptic strength often correlates with stable anchoring of the ER, followed by the formation of the spine apparatus organelle. Here we characterize the newly identified interaction of myosin V with the Ca2+-sensor caldendrin, a brain-specific homolog of the well-known myosin V interactor calmodulin. While calmodulin is an essential activator of myosin V motor function, we found that caldendrin acts as an inhibitor of processive myosin V movement. We propose that caldendrin transforms myosin into a stationary F actin tether, and show that in mouse and rat hippocampal neurons, caldendrin regulates spine apparatus localization to a subset of dendritic spines through a myosin V-dependent pathway.

2022-01-27 | PXD029427 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data