Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment [RNA-seq]

ABSTRACT: Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment [RNA-seq]

PROVIDER: PRJNA848837 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR19643176.fastq.gz	Fastqsanger.gz
	SRR19643178.fastq.gz	Fastqsanger.gz
	SRR19643180.fastq.gz	Fastqsanger.gz
	SRR19643182.fastq.gz	Fastqsanger.gz
	SRR19643184.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 6

Similar Datasets

Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment

Project description:Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment

| PRJNA848833 | ENA

Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment [Ribo-seq]

Project description:Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment [Ribo-seq]

| PRJNA848829 | ENA

Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment [RNA-seq]

Project description:This study demonstrates the dichotomous activities of APRIL and BAFF in MM and DLBCL, which can be safely targeted by an engineered fusion protein designed to trap both ligands with ultrahigh binding affinity.

2022-06-18 | GSE206044 | GEO

Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment [Ribo-seq]

2022-06-18 | GSE206040 | GEO

Developing High-Affinity Decoy Receptor Optimized for Multiple Myeloma and Diffuse Large B Cell Lymphoma Treatment

Project description:This SuperSeries is composed of the SubSeries listed below.

2022-06-18 | GSE206045 | GEO

Developing high-affinity decoy receptors to treat multiple myeloma and diffuse large B cell lymphoma.

Project description:Disease relapse and treatment-induced immunotoxicity pose significant clinical challenges for patients with hematological cancers. Here, we reveal distinctive requirements for neutralizing TNF receptor ligands APRIL and BAFF and their receptor activity in MM and DLBCL, impacting protein translation and production in MM cells and modulating the translation efficiency of the ATM interactor (ATMIN/ACSIZ). Therapeutically, we investigated the use of BCMA decoy receptor (sBCMA-Fc) as an inhibitor of APRIL and BAFF. While wild-type sBCMA-Fc effectively blocked APRIL signaling in MM, it lacked activity in DLBCL due to its weak BAFF binding. To expand the therapeutic utility of sBCMA-Fc, we engineered an affinity-enhanced mutant sBCMA-Fc fusion molecule (sBCMA-Fc V3) 4- and 500-fold stronger in binding to APRIL and BAFF, respectively. The mutant sBCMA-Fc V3 clone significantly enhanced antitumor activity against both MM and DLBCL. Importantly, we also demonstrated an adequate toxicity profile and on-target mechanism of action in nonhuman primate studies.

| S-EPMC9428257 | biostudies-literature

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Cell cycle motif decoy oligos

2012-08-23 | GSE39572 | GEO

Expression data from U87-2M1 glioma cells transduced with baculoviral control decoy vector or baculoviral miR-10b decoy vector

Project description:MicroRNA-10b may target numerous genes in gliomagenesis. The target genes of miR-10b may differ according to the cellular context. We used microarray analyses to determine the phenotypic effects and gene targets of miR-10b by silencing miR-10b in invasive U87-2M1 glioma cells. Early passage U87-2M1 cells treated with the baculoviral control decoy vector or miR-10b decoy vector were selected for RNA extraction and hybridization on microarray

2012-12-31 | E-GEOD-35170 | biostudies-arrayexpress

An engineered decoy receptor for SARS-CoV-2 broadly binds protein S sequence variants

Project description:The spike S of SARS-CoV-2 recognizes ACE2 on the host cell membrane to initiate entry. Soluble decoy receptors, in which the ACE2 ectodomain is engineered to block S with high affinity, potently neutralize infection and, due to close similarity with the natural receptor, hold out the promise of being broadly active against virus variants without opportunity for escape. Here, we directly test this hypothesis. Using deep mutagenesis, we find that the ACE2-binding surface of the SARS-CoV-2 spike tolerates high mutational diversity, which may act as a source for resistance to therapeutics. However, saturation mutagenesis of the receptor-binding domain (RBD) followed by in vitro selection, with wild type ACE2 and the engineered decoy competing for binding sites, failed to find S mutants that discriminate in favor of the wild type receptor. We conclude that resistance to engineered decoys will be rare.

2020-10-18 | GSE159372 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data