Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq of Eca109 cells.

ABSTRACT: RNA-seq of Eca109 cells.

PROVIDER: PRJNA876710 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR21416144_1.fastq.gz	Fastqsanger.gz
	SRR21416144_2.fastq.gz	Fastqsanger.gz
	SRR21416145_1.fastq.gz	Fastqsanger.gz
	SRR21416145_2.fastq.gz	Fastqsanger.gz
	SRR21416146_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 12

Similar Datasets

RNA-Seq of PRMT1 overexpression ECA109 cells

Project description:RNA-Seq of PRMT1 overexpression ECA109 cells

| PRJNA529370 | ENA

RNA-Seq of LEF1 overexpression ECA109 cells

Project description:RNA-Seq of LEF1 overexpression ECA109 cells

| PRJNA529369 | ENA

RNA-Seq of LEF1 overexpression ECA109 cells

Project description:RNA-seq was performed on three biological replicates. Total RNA from ECA109 LV-GFP/LV-LEF1.Differentially expression genes were considered to be significant between groups when the P-value was <0.05 and the fold change of expression was ≥2-fold or ≤0.5-fold. By this way, the RNA-Seq data showed the differential expression genes in LEF1 overexpression ECA109 cells compared with NC cells. Furthermore, Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of the differentially expressed genes in the experiment. Pathway analysis was used to find out the significant pathway of the differentially expressed genes according to KEGG database. In conclusion, our study represents the first detailed analysis of LEF1 transcriptomes in esophageal squamous cell carcinoma cells.

2020-04-10 | GSE128914 | GEO

RNA-Seq of PRMT1 overexpression ECA109 cells

Project description:RNA-seq was performed on three biological replicates. Total RNA from ECA109 LV-GFP/LV-PRMT1.Differentially expressed genes were considered to be significant between groups when the P-value was <0.05 and the fold change of expression was ≥2-fold or ≤0.5-fold. By this way, the RNA-Seq data showed the differential expression genes in PRMT1 overexpression ECA109 cells compared with NC cells. Furthermore, Gene ontology (GO) analysis was performed to facilitate elucidating the biological implications of the differentially expressed genes in the experiment. Pathway analysis was used to find out the significant pathway of the differentially expressed genes according to KEGG database. In conclusion, our study represents the first detailed analysis of PRMT1 transcriptomes in esophageal squamous cell carcinoma cells.

2019-05-09 | GSE128913 | GEO

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).

2025-02-21 | GSE290209 | GEO

Effect of depletion of USP36 on gene expression of ECA109 cells, esophageal squamous cell carcinoma cell line.

Project description:To investigate the function of USP36 in the regulation of cell proliferation and escc progression, we established eca109 cell lines in which each target gene has been knocked down by siRNA.We then performed gene expression profiling analysis using data obtained from RNA-seq of 6 different cells at same time points.

2023-01-04 | GSE206845 | GEO

RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

Project description:RNA-seq analysis of differentially expressed genes between WT and KD ZC3H18 KYSE150/ECA109 cells.

| PRJNA1226578 | ENA

RNA-Seq on Eca109 and KYSE450 cell lines with DMSO and Elaiophylin treatment

Project description:RNA-Seq on Eca109 and KYSE450 cell lines with DMSO and Elaiophylin treatment

| PRJNA718583 | ENA

RNA-Seq Analysis

Project description:RNA-Seq analysis carried out in three different backcrosses based on Iberian breed with Landrace, Pietrain and Duroc breeds

2017-10-31 | PRJEB23068 | EVA