Ontology highlight
ABSTRACT:
PROVIDER: PRJNA885028 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR21737267_1.fastq.gz | Fastqsanger.gz | |||
| SRR21737268_1.fastq.gz | Fastqsanger.gz | |||
| SRR21737269_1.fastq.gz | Fastqsanger.gz | |||
| SRR21737270_1.fastq.gz | Fastqsanger.gz | |||
| SRR21737271_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 12 |
Similar Datasets
Project description:Transposon insertion site sequencing (TIS) is a powerful method for associating genotype to phenotype. However, all TIS methods described to date use short nucleotide sequence reads which cannot uniquely determine the locations of transposon insertions within repeating genomic sequences where the repeat units are longer than the sequence read length. To overcome this limitation, we have developed a TIS method using Oxford Nanopore sequencing technology that generates and uses long nucleotide sequence reads; we have called this method LoRTIS (Long Read Transposon Insertion-site Sequencing). This experiment data contains sequence files generated using Nanopore and Illumina platforms. Biotin1308.fastq.gz and Biotin2508.fastq.gz are fastq files generated from nanopore technology. Rep1-Tn.fastq.gz and Rep1-Tn.fastq.gz are fastq files generated using Illumina platform. In this study, we have compared the efficiency of two methods in identification of transposon insertion sites.
2022-05-30 | E-MTAB-11351 | biostudies-arrayexpress
Project description:We sequenced DNA from the leaves of ten Col x Ler F1 hybrid plants (WT and recq4) using Nanopore long-read sequencing and identified crossover sites with COmapper. These data were used as a negative control for COmapper, as no crossover sites were expected to be detected. For nanopore sequencing of gDNA from leaves, leaves from 10 5-week-old plants were ground in liquid nitrogen using a mortar and pestle. The ground tissue was resuspended in four volumes of CTAB buffer (1% [w/v] CTAB, 50 mM Tris-HCl pH 8.0, 0.7 M NaCl, 10 mM EDTA) and incubated at 65°C for 30 min. Following chloroform extraction, isopropanol precipitation and removal of RNAs as above, the gDNA pellet was resuspended in 150 μl TE (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA) buffer and gDNA was quantified using a Qubit dsDNA Broad Range assay kit (Thermo Fisher, Q32853). Nine micrograms of gDNA from pollen or seedlings was used to construct a nanopore long-read sequencing library using a Ligation Sequencing Kit V14 (Nanopore, SQK-LSK114). The libraries were sequenced using a PromethION platform (BGI, Hong Kong).
2024-08-19 | E-MTAB-14381 | biostudies-arrayexpress
Project description:This dataset contains Xdrop followed by oxford nanopore long read sequencing performed in target tRNA gene deletion clones in HAP1 (t72) and HepG2 (t15). By applying de novo assembly based approach to Xdrop-LRS data, we identified Cas9-induced on-target genomic alteration.
2022-09-16 | E-MTAB-10652 | biostudies-arrayexpress
Project description:Nanopore long-read sequencing was used to generate a complete assembly of the Arabidopsis centromeres.
2021-04-02 | E-MTAB-10272 | biostudies-arrayexpress
Project description:This dataset contains Xdrop followed by oxford nanopore long read sequencing performed in target tRNA gene deletion (t8) and intergenic region deletion (i50) clones in HepG2 . By applying de novo assembly based approach to Xdrop-LRS data, we identified Cas9-induced on-target genomic alteration.
2022-09-16 | E-MTAB-11327 | biostudies-arrayexpress
Project description:We sequenced DNA from a bulk of Col x Ler F2 hybrid plants (WT and recq4) using Nanopore long-read sequencing and identified crossover sites with COmapper. For nanopore sequencing of gDNA from 1,000 pooled seedlings, 10-day-old seedlings were ground in liquid nitrogen using a mortar and pestle. The ground tissue was resuspended in four volumes of CTAB buffer (1% [w/v] CTAB, 50 mM Tris-HCl pH 8.0, 0.7 M NaCl, 10 mM EDTA) and incubated at 65°C for 30 min. Following chloroform extraction, isopropanol precipitation and removal of RNAs as above, the gDNA pellet was resuspended in 150 μl TE (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA) buffer and gDNA was quantified using a Qubit dsDNA Broad Range assay kit (Thermo Fisher, Q32853). Nine micrograms of gDNA from pollen or seedlings was used to construct a nanopore long-read sequencing library using a Ligation Sequencing Kit V14 (Nanopore, SQK-LSK114). The libraries were sequenced using a PromethION platform (BGI, Hong Kong).
2024-08-19 | E-MTAB-14368 | biostudies-arrayexpress
Project description:We used the nanopore Cas9 targeted sequencing (nCATS) strategy to specifically sequence 125 L1HS-containing loci in parallel and measure their DNA methylation levels using nanopore long-read sequencing. Each targeted locus is sequenced at high coverage (~45X) with unambiguously mapped reads spanning the entire L1 element, as well as its flanking sequences over several kilobases. The genome-wide profile of L1 methylation was also assessed by bs-ATLAS-seq in the same cell lines (E-MTAB-10895).
2023-09-22 | E-MTAB-12247 | biostudies-arrayexpress
Project description:Whole-genome bisulfite sequencing (WGBS) is currently the gold standard for DNA methylation (5-methylcytosine, 5mC) profiling, however the destructive nature of sodium bisulfite results in DNA fragmentation and subsequent biases in sequencing data. Such issues have led to the development of bisulfite-free methods for 5mC detection. Nanopore sequencing is a long read non-destructive approach that directly analyzes DNA and RNA fragments in real time. Recently, computational tools have been developed that enable base-resolution detection of 5mC from Oxford Nanopore sequencing data. In this chapter we provide a detailed protocol for preparation, sequencing, read assembly and analysis of genome-wide 5mC using Nanopore sequencing technologies.
2021-12-03 | GSE179673 | GEO
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress