Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S v4-v5 amplicon sequencing AD bioreactor

PROVIDER: PRJNA885972 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR21779921_1.fastq.gz	Fastqsanger.gz
	SRR21779921_2.fastq.gz	Fastqsanger.gz
	SRR21779922_1.fastq.gz	Fastqsanger.gz
	SRR21779922_2.fastq.gz	Fastqsanger.gz
	SRR21779923_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 114

Similar Datasets

freshwater metagenome

Project description:16S rRNA amplicon sequencing (V4+V5) from Japanese deep lakes

| PRJDB5151 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

soil metagenome

Project description:Bacterial 16S rRNA V4-V5 regions

| PRJNA336256 | ENA

LC-MS/MS of autotrophic culture BP, that performs nitrate reduction coupled to iron(II) oxidation (NDFO)

Project description:Nitrate-reducing iron(II)-oxidizing (NDFO) bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. A second NDFO culture, culture BP, was obtained with a sample taken in 2015 at the same pond and cultured in a similar way. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture BP. Raw sequencing data of 16S rRNA amplicon sequencing (V4 region with Illumina and near full-length with PacBio), shotgun metagenomics, metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA693457. This dataset contains proteomics data for 2 conditions in triplicates. Samples R23, R24, and R25 are grown in autotrophic conditions, samples R26, R27, and R28 in heterotrophic conditions.

2021-05-17 | PXD023710 | Pride

7a75f7bd-831c-4b1a-9a69-e36963fb9e78 - samples

Project description:Amplicon sequencing from 45 samples - Amplicons of 16s v3-v4

| EGAD00001005027 | EGA

Multiomic Approach to Analyze Infant Gut Microbiota: Experimental and Analytical Method Optimization

Project description:BACKGROUND: The human intestinal microbiome plays a central role in overall health status, especially in early life stages. 16S rRNA amplicon sequencing is used to profile its taxonomic composition; however, multiomic approaches have been proposed as the most accurate methods for study of the complexity of the gut microbiota. In this study, we propose an optimized method for bacterial diversity analysis that we validated and complemented with metabolomics by analyzing fecal samples.METHODS: Forty-eight different analytical combinations regarding (1) 16S rRNA variable region sequencing, (2) a feature selection approach, and (3) taxonomy assignment methods were tested. A total of 18 infant fecal samples grouped depending on the type of feeding were analyzed by the proposed 16S rRNA workflow and by metabolomic analysis.RESULTS: The results showed that the sole use of V4 region sequencing with ASV identification and VSEARCH for taxonomy assignment produced the most accurate results. The application of this workflow showed clear differences between fecal samples according to the type of feeding, which correlated with changes in the fecal metabolic profile.CONCLUSION: A multiomic approach using real fecal samples from 18 infants with different types of feeding demonstrated the effectiveness of the proposed 16S rRNA-amplicon sequencing workflow.

2021-08-18 | MTBLS2942 | MetaboLights

food fermentation metagenome

Project description:16S V3-V4 amplicon sequencing

| PRJDB9082 | ENA

Project description:Archaeal 16S v4 amplicon

| PRJNA1134647 | ENA

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Project description:Microbial eukaryotic 18S V4 amplicon and prokaryotic 16S V4 amplicon

| PRJNA777784 | ENA