Ontology highlight
ABSTRACT:
PROVIDER: PRJNA937687 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR23585100_1.fastq.gz | Fastqsanger.gz | |||
| SRR23585100_2.fastq.gz | Fastqsanger.gz | |||
| SRR23585101_1.fastq.gz | Fastqsanger.gz | |||
| SRR23585101_2.fastq.gz | Fastqsanger.gz | |||
| SRR23585102_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 194 |
Similar Datasets
Project description:Based on the hypothesis that, enhancing the local concentration of donor oligos could increase the correction rates, we generated and tested novel CRISPR-Cas9 systems, in which the DNA repair template is covalently conjugated to Cas9 (RNPD system). To validate our results from the HEK293T reporter cells, we here tested our approach at different endogenous genomic loci and in different cell types. We first targeted the human beta globin (HBB) locus in the K562 cell line, and analyzed correction- and editing frequencies using next generation sequencing (NGS). Next we targeted the Rosa26 and proprotein convertase subtilisin/kexin type 9 (Pcsk9) locus in mouse embryonic stem cells (mESCs). Here, RNPD system was always compared to Cas9 SNAP-tag fusion proteins with uncoupled donor oligos. To also directly compare the engineered RNPD system to the classical CRISPR-Cas9 system, we performed experiments where we used wild-type Cas9 with the uncoupled donor oligos as a control. We therefore targeted the fluorescent reporter locus as well as the endogenous loci HBB, empty spiracles homeobox 1 (EMX1), and C-X-C chemokine receptor type 4 (CXCR4) in HEK293T cells. Finally, we performed the analysis of three computationally predicted off-target sites of the reporter locus.
2018-06-04 | E-MTAB-6808 | biostudies-arrayexpress
Project description:CRISPR-Cas is an RNA-based defense system that enables prokaryotes to recognize invading foreign DNA by cognate crRNA guides and destroy it by CRISPR-associated Cas nucleases 1,2 . Elucidation of the interference mechanism of the Streptococcus pyogenes Type II CRISPR- Cas9 system has allowed for the successful repurposing of SpCas9 as a generic genome editing tool, with great promise for human gene therapy 3 . However, especially for therapeutic applications, some caution seems appropriate, because Cas9 systems from some human pathogens may induce a cytotoxic response via an unknown mechanism 4 . Here we show that when released in human cells, Cas9 nucleases from the pathogenic bacteria Campylobacter jejuni and S. pyogenes have the potential to cause severe DNA damage. In the absence of a CRISPR RNA guide, native Cas9 nucleases from both pathogens enter the host nucleus, where their presence leads to promiscuous double stranded DNA breaks (DSBs) and induction of cell death. DSB induction can be reduced to background levels either by saturation of CjCas9 and SpCas9 with crRNA guides or by inactivating their nuclease activity. Our results demonstrate that guide-free Cas9 of bacterial pathogens might play an important role in pathogenicity. Furthermore, we propose that saturating Cas9 with appropriate guide RNAs is crucial for efficient and safe therapeutic applications.
2022-03-02 | PXD006712 | Pride
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:We have developed a therapeutic strategy for beta-hemoglobinopathies aimed at reactivating fetal hemoglobin expression in red blood cells derived from human hematopoietic stem/progenitor cells edited with CRISPR/Cas9 nucleases, cytidine or adenine base editors targeting the fetal gamma-globin promoters. Here, we report the transcriptomic changes occurring in human hematopoietic stem/progenitor cells (obtained from healthy donors) 48 h after transfection with CRISPR/Cas9 nucleases, cytidine or adenine base editors.
2022-09-06 | GSE191135 | GEO
Project description:Chromosomal rearrangements including large DNA-fragment inversions, deletions, and duplications by Cas9 with paired sgRNAs are important to investigate structural genome variations and developmental gene regulation, but little is known about the underlying mechanism. Here we report that disrupting CtIP or FANCD2, which is thought to function in NHEJ, enhances precise DNA-fragment deletion. In addition, by analyzing the inserted nucleotides at the junctions of DNA-fragment deletions, inversions, duplications, and characterizing the cleaved products, we find that Cas9 endonucleolytically cleaves the noncomplementary strand with a flexible scissile profile upstream of -3 position of the PAM site in vivo and in vitro, generating overhanged DSB ends. Moreover, we find that engineered Cas9 nucleases have distinct cleavage profiles. Finally, Cas9-mediated nucleotide insertions are nonrandom and are equal to the combined sequences upstream of both PAM sites with predicted frequencies. Thus, precise and predictable DNA-fragment editing could be achieved by perturbing DNA repair genes and using appropriate PAM configurations. These findings have important implications regarding 3D chromatin folding and enhancer insulation during gene regulation.
2018-07-26 | GSE113698 | GEO
Project description:The structure of broken DNA ends is a critical determinant of the pathway used for DNA double strand break (DSB) repair. Here, we develop an approach, hairpin capture of DNA end structures (HCoDES), which elucidates chromosomal DNA end structures at single nucleotide resolution. HCoDES defines structures of physiologic DSBs generated by the RAG endonuclease, as well as those generated by nucleases widely used for genome editing. Analysis of G1-phase cells deficient in H2AX or 53BP1 reveals DNA ends that are frequently resected to form long single-stranded overhangs that can be repaired by mutagenic pathways. In addition to 3’ overhangs, many of these DNA ends unexpectedly form long 5’ single-stranded overhangs. The divergence in DNA end structures resolved by HCoDES suggests that H2AX and 53BP1 may have distinct activities in end protection. Thus, the high-resolution end structures obtained by HCoDES identify new features of DNA end processing during DSB repair. Single stranded DNA ligation of genomic DNA isolated from G1 arrested LigaseIV-/-, LigaseIV-/- 53BP1-/- and LigaseIV-/- H2AX-/- Abelson pre-B cells harboring site specific DSBs generated by the RAG recombinase, Cas9 endonuclease or Zinc Finger Endonuclease.
2014-12-03 | E-GEOD-62534 | biostudies-arrayexpress
Project description:We describe a robust linear amplification-mediated high-throughput genome-wide translocation sequencing (HTGTS) method that identifies endogenous or ectopic "prey" DNA double-stranded breaks (DSBs) across the human genome based on their translocation to "bait" DSBs generated by engineered nucleases. HTGTS with different Cas9:gRNA or TALEN-nuclease on-target baits revealed off-target hotspots for given nucleases that ranged from few or none to dozens or more, and greatly extended known off-target numbers for certain previously characterized engineered nucleases by more than 10-fold. Beyond various types of nuclease off-target collateral damage, we also identified collateral damage in the form of translocations between bona fide nuclease targets on homologous chromosomes. Based on frequent non-specific DSBs making any given human chromosome an HTGTS hotspot region for bait DSBs within it, we found that HTGTS also reveals wide-spread, low-level DSB-generating activities of engineered nucleases. Finally, HTGTS confirmed that the Cas9D10A paired nickase approach suppresses off-targets genome-wide and suggested other strategies to enhance desired nuclease activities.
2014-11-29 | GSE57283 | GEO
Project description:Our research has demonstrated that G-CSF impedes engraftment of CRISPR-Cas9 gene edited human hematopoietic stem cells (HSCs) by exacerbating p53-mediated DNA damage response. Results in this study suggest that the potential for G-CSF to exacerbate HSC toxicity mediated by DNA-damaging nucleases should be considered in autologous HSC gene therapy clinical trials.
2023-06-30 | GSE230182 | GEO
Project description:Because of their smallness, the recently developed CRISPR-Cas12f nucleases can be effectively packaged into adeno-associated viruses for gene therapy. However, a systematic evaluation of the editing outcomes of CRISPR-Cas12f is lacking. In this study, we apply a high-throughput sequencing method to comprehensively assess the editing efficiency, specificity, and safety of four Cas12f proteins in parallel with that of Cas9 and two Cas12a proteins at multiple genomic sites. Cas12f nucleases achieve robust cleavage at most of the tested sites and mainly produce deletional fragments. In contrast, Cas9 and Cas12a show relatively higher editing efficiency at the vast majority of the tested sites. However, the off-target hotspots identified in the Cas9- and Cas12a-edited cells are negligibly detected in the Cas12f-edited cells. Moreover, compared to Cas9 and Cas12a nucleases, Cas12f nucleases reduce the levels of chromosomal translocations, large deletions, and integrated vectors by 2- to 3-fold. Therefore, our findings confirm the editing capacity of Cas12f and reveal the ability of this nuclease family to preserve genome integrity during genome editing.
2022-09-12 | GSE213149 | GEO