Project description:Bacteriophage – host dynamics and interactions are important for microbial community composition and ecosystem function. Nonetheless, empirical evidence in engineered environment is scarce. Here, we examined phage and prokaryotic community composition of four anaerobic digestors in full-scale wastewater treatment plants (WWTPs) across China. Despite relatively stable process performance in biogas production, both phage and prokaryotic groups fluctuated monthly over a year of study period. Nonetheless, there were significant correlations in their α- and β-diversities between phage and prokaryotes. Phages explained 40.6% of total prokaryotic community composition, much higher than the explainable power by abiotic factors (14.5%). Consequently, phages were significantly (P<0.010) linked to parameters related to process performance including biogas production and volatile solid concentrations. Association network analyses showed that phage-prokaryote pairs were deeply rooted, and two network modules were exclusively comprised of phages, suggesting a possibility of co-infection. Those results collectively demonstrate phages as a major biotic factor in controlling bacterial composition. Therefore, phages may play a larger role in shaping prokaryotic dynamics and process performance of WWTPs than currently appreciated, enabling reliable prediction of microbial communities across time and space.
Project description:Neisseria meningitidis is a major cause of bacterial meningitis and septicemia worldwide. Seven new serogroup C meningococci were isolated from two provinces of China in January, 2006. Their PorA VR types were P1.20, 9. Multilocus sequence typing results indicated that they all belonged to ST-7. It is a new serogroup C N. meningitidis sequence type clone identified in China. Here we also present the results of a genomic comparison of these isolates with other 15 N. meningitidis serogroup A and B isolates, which belonged to ST-7, based on comparative genomic hybridization analysis. The data described here would be helpful to monitor the spread of this new serogroup C meningococci sequence type clone in China and worldwide. Keywords: comparative genomic hybridization
Project description:Accurate description of a microbial community is an important first step in understanding the role of its components in ecosystem function. A method for surveying microbial communities termed Serial Analysis of Ribosomal DNA (SARD) is described here. Through a series of molecular cloning steps, short DNA sequence tags are recovered from the fifth variable (V5) region of the prokaryotic 16S rRNA gene from microbial communities. These tags are ligated to form concatemers comprised of 20-40 tags which are cloned and identified by DNA sequencing. Four agricultural soil samples were profiled with SARD to assess the method’s utility. A total of 37,008 SARD tags comprising 3,127 unique sequences were identified. Comparison of duplicate profiles from one soil genomic DNA preparation revealed the method was highly reproducible. The large numbers of singleton tags together with non-parametric richness estimates indicated a significant amount of sequence tag diversity remained undetected with this level of sampling. The abundance classes of the observed tags were scale-free and conformed to a power law distribution. Numerically, the majority of the total tags observed belonged to abundance classes that were each present at less than 1% of the community. Over 99% of the unique tags individually made up less than 1% of the community. Therefore, from either numerical or diversity standpoints, low abundant taxa comprised a significant proportion of the microbial communities examined and could potentially make a large contribution to ecosystem function. SARD may provide a means to explore the ecological role of these rare members of microbial communities in qualitative and quantitative terms. Keywords: SARD profiles, culture-independent study, microbial community survey, microbial census
Project description:Known as “The Oriental Botanic Garden” and the natural gene bank of biological species, Shennongjia is one of the most biologically diverse areas in China and a member of UNESCO's World Network of Biosphere Reserves. The macro-organism resources of shennongjia have been deeply explored. However, the microbial community structure was scarcely detected. In this study, we aim to detedect the microbial community along six sites of Shennonajia Mountain and explore the major controlling factor in shaping microbial community with a microarray-based metagenomics tool named GeoChip 4.2.
Project description:Soil transplant serves as a proxy to simulate climate change in realistic climate regimes. Here, we assessed the effects of climate warming and cooling on soil microbial communities, which are key drivers in Earth’s biogeochemical cycles, four years after soil transplant over large transects from northern (N site) to central (NC site) and southern China (NS site) and vice versa. Four years after soil transplant, soil nitrogen components, microbial biomass, community phylogenetic and functional structures were altered. Microbial functional diversity, measured by a metagenomic tool named GeoChip, and phylogenetic diversity are increased with temperature, while microbial biomass were similar or decreased. Nevertheless, the effects of climate change was overridden by maize cropping, underscoring the need to disentangle them in research. Mantel tests and canonical correspondence analysis (CCA) demonstrated that vegetation, climatic factors (e.g., temperature and precipitation), soil nitrogen components and CO2 efflux were significantly correlated to the microbial community composition. Further investigation unveiled strong correlations between carbon cycling genes and CO2 efflux in bare soil but not cropped soil, and between nitrogen cycling genes and nitrification, which provides mechanistic understanding of these microbe-mediated processes and empowers an interesting possibility of incorporating bacterial gene abundance in greenhouse gas emission modeling.
Project description:Known as M-bM-^@M-^\The Oriental Botanic GardenM-bM-^@M-^] and the natural gene bank of biological species, Shennongjia is one of the most biologically diverse areas in China and a member of UNESCO's World Network of Biosphere Reserves. The macro-organism resources of shennongjia have been deeply explored. However, the microbial community structure was scarcely detected. In this study, we aim to detedect the microbial community along six sites of Shennonajia Mountain and explore the major controlling factor in shaping microbial community with a microarray-based metagenomics tool named GeoChip 4.2. Seventy-three samples were collected from six sites along the Shennongjia Mountain, with 5-15 replicates in every site
Project description:Samples of oil and production water were collected from five wells of the Qinghai Oilfield, China, and subjected to GeoChip hybridization experiments for microbial functional diversity profiling. Unexpectedly, a remarkable microbial diversity in oil samples, which was higher than that in the corresponding water samples, was observed, thus challenging previously believed assumptions about the microbial diversity in this ecosystem. Hierarchical clustering separated oil and water samples, thereby indicating distinct functional structures in the samples. Genes involved in the degradation of hydrocarbons, organic remediation, stress response, and carbon cycling were significantly abundant in crude oil, which is consistent with their important roles in residing in oil. Association analysis with environmental variables suggested that oil components comprising aromatic hydrocarbons, aliphatic hydrocarbons, and a polar fraction with nitrogen-, sulfur-, and oxygen-containing compounds were mainly influential on the structure of the microbial community. Furthermore, a comparison of microbial communities in oil samples indicated that the structures were depth/temperature-dependent. To our knowledge, this is the first thorough study to profile microbial functional diversity in crude oil samples. From the Qinghai Oilfield located in the Tibetan Plateau, northwest China, oil production mixtures were taken from four oil production wells (No. 813, 516, 48 and 27) and one injection well (No. 517) in the Yue-II block. The floating oil and water phases of the production mixtures were separated overnight by gravitational separation. Subsequently, the microbial community and the characteristics of the water solution (W813, W516, W48, and W27) and floating crude oil (O813, O516, O48, and O27) samples were analyzed. A similar analysis was performed with the injection water solution (W517).
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.