Highly integrated epigenome maps in Arabidopsis - transcriptome sequencing
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
SUBMITTER: Joseph Ecker
PROVIDER: E-GEOD-10968 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Publications
Highly integrated single-base resolution maps of the epigenome in Arabidopsis.
Lister Ryan R O'Malley Ronan C RC Tonti-Filippini Julian J Gregory Brian D BD Berry Charles C CC Millar A Harvey AH Ecker Joseph R JR
Cell 20080501 3
Deciphering the multiple layers of epigenetic regulation that control transcription is critical to understanding how plants develop and respond to their environment. Using sequencing-by-synthesis technology we directly sequenced the cytosine methylome (methylC-seq), transcriptome (mRNA-seq), and small RNA transcriptome (smRNA-seq) to generate highly integrated epigenome maps for wild-type Arabidopsis thaliana and mutants defective in DNA methyltransferase or demethylase activity. At single-base ...[more]
Similar Datasets
Project description:Part of a set of highly integrated epigenome maps for Arabidopsis thaliana. Keywords: Illumina high-throughput small RNA sequencing Small RNA sequencing of wildtype Arabidopsis plants (Columbia-0), and met1, drm1 drm2 cmt3, and ros1 dml2 dml3 null mutants using the Illumina Genetic Analyzer.
2008-04-20 | E-GEOD-10967 | biostudies-arrayexpress
Project description:Whole genome shotgun bisulfite sequencing, small RNA sequencing and transcriptome sequencing of wildtype Arabidopsis plants (Col-0), and met1, drm1 drm2 cmt3, and ros1 dml2 dml3 null mutants using the Illumina Genetic Analyzer. A comparison was performed with regions of the genome containing cytosine DNA methylation identified by methylcytosine immunoprecipitation and whole-genome oligonucleotide tiling microarrays, for wildtype Col-0. Understanding the epigenetic regulatory mechanisms that mediate control of transcription at multiple levels is critical to understanding how plants develop and respond to their environment. We combined next-generation sequencing by synthesis (SBS) technology with novel methods for direct sequencing of the entire cytosine methylome (methylC-seq), transcriptome (RNA-seq), and the small RNA component of the transcriptome (smRNA-seq) to create a set of highly integrated epigenome maps for Arabidopsis thaliana, in conjunction with a set of informative mutants defective in DNA methyltransferase and DNA demethylase activity. At single-base resolution we discovered extensive, previously undetected, DNA methylation, identified the context and level of methylation at each site, and found that local composition has effects upon DNA methylation state. Deep sequencing of the smRNAome exposed a direct relationship between the location and abundance of smRNAs and DNA methylation, perturbation of smRNA biogenesis upon loss of CpG DNA methylation, and a tendency for smRNAs to direct strand-specific DNA methylation in the region of RNA-DNA homology. Finally, strand-specific RNA-seq revealed changes in the transcript abundance of hundreds of genes upon alteration of the DNA methylation state, and enabled the identification of numerous previously unidentified genes regulated by DNA methylation. Keywords: Whole genome shotgun bisulfite sequencing, small RNA sequencing, transcriptome sequencing, methylcytosine immunoprecipitation, whole-genome oligonucleotide tiling microarrays Whole genome shotgun bisulfite sequencing, small RNA sequencing and transcriptome sequencing of wildtype Arabidopsis plants (Col-0), and met1, drm1 drm2 cmt3, and ros1 dml2 dml3 null mutants using the Illumina Genetic Analyzer. A comparison was performed with regions of the genome containing cytosine DNA methylation identified by methylcytosine immunoprecipitation and whole-genome oligonucleotide tiling microarrays, for wildtype Col-0.
2008-04-20 | E-GEOD-10877 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:Social caste determination in the honey bee is assumed to be determined by the dietary status of the young larvae and translated into physiological and epigenetic changes through nutrient-sensing pathways. We have employed Illumina/Solexa sequencing to examine the small RNA content in the bee larval food source, and show that worker jelly is enriched in miRNA complexity and abundance relative to royal jelly. The miRNA levels in worker jelly were 7-215 fold higher than in royal jelly, and both jellies showed dynamic changes in miRNA content during the 4th to 6th day of larval development. Adding specific miRNAs to royal jelly elicited significant changes in queen larval mRNA expression and in morphological characters of the emerging adult queen bee. We propose that miRNAs in the nurse bee secretions constitute an additional element in the regulatory control of caste determination in the honey bee. We collected worker and royal jelly of the Italian honeybee (ZND No.1, Apis mellifera ligustica) at 73~90 hours (4th-day larvae), 97~114 hours (5th-day larvae), and 121~138 hours (6th-day larvae) after hatching. After total RNA was extractedM-BM- and quantified , relative equal amounts of total RNAs from each of the three sampling days were pooled into respectively worker and royal jelly samples, and the fraction of small RNAs less than 30nt long was retained and sequenced on the Illumina/Solexa high-throughput platform (HTP).
2014-01-06 | E-GEOD-44853 | biostudies-arrayexpress
Project description:Honeybees are very important eusocial insects and are involved in the pollination of many plants. Queen bees and worker bees develop from the same fertilized eggs, and are thus genetically identical despite their substantial behavioural and physiological differences. The mechanism governing developmental differences between worker and queen bees has always attracted much interest. While there are several reports on mRNA expression related to caste differentiation, no systematic investigation of small RNAs has thus far been carried out. Results: Using deep sequencing we systematically profiled small RNA expression in 4th-6th day worker larvae and queen larvae (the critical stages at which the fates of workers and queens are determined), and found that 38 miRNAs were differentially expressed between worker and queen larvae. In addition, 639 mature miRNA candidates were identified in our work for the first time, of which, 526 were expressed only in workers (318) or queens (208). Conclusion: We present the first profile of honeybee small RNAs and explore the mechanism of caste differentiation between worker and queen bees. Caste-specific expression patterns and large discrepancies in small RNA profiles between worker and queen bees indicate that small RNAs may be related to the differential development of worker and queen bee larvae. Results presented here will make a valuable contribution to understanding the caste switch between worker and queen bees. Three healthy 10-frame colonies of ‘Zhenongda No.1’- a high-yielding royal jelly breed of Apis mellifera ligustica , were maintained at the Huajiachi campus of Zhejiang University. In each colony, the queen laid eggs over a period of 24 hours in one empty frame which was subsequently moved to an egg-free super-chamber. After 66 hours (less than 18 hours after hatching), we transferred 150 larvae into queen cups to rear queens in each colony and put the queen cup frames into their corresponding colonies. 40-60 worker larvae and queen larvae were collected from each colony after 4 days (73~90 h after hatching), 5 days (97~114 h after hatching) and 6 days (121~138 h after hatching). The larval samples were collected into 50 ml tubes, immediately frozen in liquid nitrogen and stored at -80C until being used for RNA extraction. After total RNA was extracted and quantified , relative equal amounts of total RNAs from each of the three sampling days were pooled into respectively worker and queen samples, and the fraction of small RNAs less than 30nt long was retained and sequenced on the Illumina/Solexa high-throughput platform (HTP).
2014-07-28 | E-GEOD-52630 | biostudies-arrayexpress
Project description:Small RNAs constitute a new and unanticipated layer of gene regulation present in the three domains of life. In plants, all organs are ultimately derived from a few pluripotent stem cells localized in specialized structures called apical meristems. The development of meristems involves a coordinated balance between undifferentiated growth and differentiation, a phenomenon requiring a tight regulation of gene expression. We used in vitro cultured embryogenic calli as a model to investigate the roles of meristem-associated small RNAs. Using high-throughput sequencing, we sequenced 20 million short reads with size of 18-30nt from rice undifferentiated and differentiated calli. We confirmed 50 known microRNA families, representing one third of annotated rice microRNAs. Using a specific computational pipeline for plant microRNA identification, we identified 24 novel microRNA families. Among them, 53 microRNA or microRNA* sequences appear to vary in expression between differentiated and undifferentiated calli, suggesting a role in meristem development. Our analysis also revealed a new class of plant small RNAs derived from 5' or 3' ends of mature tRNA analogous to the tRFs in human cancer cell. We independently verified the expression of these small RNAs from 5' end of mature tRNA using qRT-PCR. Examination of 2 different small RNA expression profilings in 2 developmental stages of meristems.
2011-03-07 | E-GEOD-27699 | biostudies-arrayexpress
Project description:S2 cells were infected with FHV deltaB2 particle and the S2 cells were harvested to isolate total RNA at 96 hpi. Small RNAs were separated on a denaturing 15% polyacrylamide gel. Ligation to adapters requires 5' monophosphate and 3' OH. Note: The base quality (.qual) file corresponding to the fasta format (.fna) file linked to Sample GSM306489 is unavailable. Small RNAs were sequenced from S2 cell after virus infection.
2008-10-15 | E-GEOD-12527 | biostudies-arrayexpress
Project description:Background: RNA silencing pathways play critical roles in gene regulation, virus infection, and transposon control. RNA interference (RNAi) is mediated by small interfering RNAs (siRNAs), which are liberated from double stranded (ds) RNA precursors by Dicer and direct the RNA-induced silencing complex (RISC) to target transcripts. Recent efforts have uncovered important principles governing small RNA (smRNA) sorting into RISC, yet mechanisms defining substrate selection by Dicer proteins remain uncharacterized. Methodology: To better characterize Dicer-2 substrates in Drosophila, we examined the antiviral RNAi response, which generates virus-derived siRNAs from viral RNA. Using high-throughput sequencing, we found that diverse viruses were uniquely targeted; substrates included dsRNA replication intermediates and intramolecular RNA stem loops. smRNA distribution patterns from viral and synthetic dsRNA precursors were highly reproducible, and machine learning techniques identified characteristics of precursor molecules and smRNA duplexes important in determining relative smRNA abundance. Significance: To our knowledge, this study provides the first description of the rules governing Dicer-2 substrate selection, which has important implications for exogenous RNA silencing technologies and the development of smRNA-based antiviral therapeutics. virus-derived siRNA (vsiRNA) expression comparison between control and 4 different virus-infected cells in control as well as 5 different RNAi pathway protein knock-downs in Drosophila dl1 cells
2013-01-31 | E-GEOD-28957 | biostudies-arrayexpress
Project description:Loss of CLP1 activity results in the accumulation of novel sets of small RNA fragments derived from aberrant processing of tyrosine pre-tRNA. Such tRNA fragments sensitize cells to oxidative stress-induced p53 activation and p53-dependent cell death. 2 samples, Wt and Clp1(k/k), no replicates
2013-04-03 | E-GEOD-39275 | biostudies-arrayexpress
Project description:Maize LEAFBLADELESS1 (LBL1) and Arabidopsis SUPPRESSOR OF GENE SILENCING3 (SGS3) play orthologous roles in the biogenesis of 21 nucleotide trans-acting short-interfering RNAs (tasiRNAs). The phenotypes conditioned by mutation of lbl1 and SGS3 are, however, strikingly different, suggesting that the activities of these small RNA biogenesis components, or the tasiRNAs and their targets might not be entirely conserved. To investigate the basis for this phenotypic variation, we compared the small RNA content between wild-type and lbl1 seedling apices. We show that LBL1 affects all major classes of small RNAs, and reveal unexpected crosstalk between tasiRNA biogenesis and other small RNA pathways regulating miRNAs, retrotransposons, and DNA transposons. We further identified genomic regions generating phased siRNAs, including numerous loci generating 22-nt phased small RNAs from long hairpin RNAs or overlapping antisense transcripts not previously described in other plant species. By combining both analyses, we identified nine TAS loci, all belonging to the conserved TAS3 family. Contrary to other plant species, no TAS loci targeted by a single miRNA were identified. Information from target prediction, RNAseq, and PARE analyses identified the tasiARFs as the major functional tasiRNAs in the maize vegetative apex where they regulate expression of ARF3 homologs. As such, divergence in TAS pathways is unlikely to account for the distinct phenotypes of tasiRNA biogenesis mutants in Arabidopsis and maize. Instead, the data suggests variation in the spatiotemporal regulation of ARF3, or divergence in its function, as a plausible basis for the dramatic phenotypic differences observed upon mutation of SGS3/lbl1 in Arabidopsis and maize. An analysis of tasiRNA biogenesis, activity, and contribution to developmental phenotypes in the maize leaf. Data generated includes small RNA sequencing data and mRNA sequencing data. All data was generated in both wild type and lbl1 mutant maize leaf apices. Three replicates were generated for each genotype for the small RNA data. Two of these replicates were also used for the RNA-seq data.
2014-11-20 | E-GEOD-50557 | biostudies-arrayexpress