Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SiRNAs 15-29 nucleotides long with 100 percent hit to Turnip mosaic virus clone GBR98

ABSTRACT: Mustard (Brassica juncea) was tested for Turnip mosaic virus infection. Small RNA of the plant was extracted and converted to DNA according to Ho, T., et al. (2006) Journal of Virological Methods 136:217-223, with primers modified to contain 454 adapter nucleotide sequences. The DNA then passed quality control through Bioanalyzer and Nanodrop before sequenced by 454 Life Sciences. Keywords: siRNA One sample analyzed by 454 high-throughput sequencing technology

ORGANISM(S): Turnip mosaic virus

SUBMITTER: Thien Ho

PROVIDER: E-GEOD-12053 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

siRNAs 15-29 nucleotides long with 100 percent hit to Turnip mosaic virus clone GBR98

Project description:Mustard (Brassica juncea) was tested for Turnip mosaic virus infection. Small RNA of the plant was extracted and converted to DNA according to Ho, T., et al. (2006) Journal of Virological Methods 136:217-223, with primers modified to contain 454 adapter nucleotide sequences. The DNA then passed quality control through Bioanalyzer and Nanodrop before sequenced by 454 Life Sciences. Keywords: siRNA

2008-09-12 | GSE12053 | GEO

siRNAs 15-29 nucleotides long with 100 percent hit to Cocksfoot streak virus

Project description:Cocksfoot grass (Dactylis glomerata) collected from Wytham, Oxford, UK, was tested for Cocksfoot streak virus infection. Small RNA of the grass was extracted and converted to DNA according to Ho, T., et al. (2008) Biochem Biophys Res Commun. 368:433-7, with primers modified to contain 454 adapter nucleotide sequences. The DNA then passed quality control through Bioanalyzer and Nanodrop before sequenced by 454 Life Sciences. Keywords: siRNA One sample analyzed by 454 high-throughput sequencing technology

2008-09-11 | E-GEOD-12052 | biostudies-arrayexpress

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Turnip crinkle virus

Project description:Turnip crinkle virus Variation

| PRJNA386437 | ENA

Turnip succinylation modification

Project description:Quantitative succinyl-proteome profiling of turnip (Brassica rapa var. rapa) in response to cadmium stress.

2022-08-11 | PXD028098 | Pride

sRNAseq from Arabidopsis leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Sequencing of small RNAs from Arabidopsis leaves non-infected and infected with Turnip mosaic virus at 14 days post inoculation

2018-03-01 | GSE110940 | GEO

Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus (TuMV)

Project description:Transcriptome sequencing from Nicotiana benthamiana leaves non-infected and infected with Turnip mosaic virus at 6 days post inoculation.

2021-02-25 | GSE167415 | GEO

Turnip yellow mosaic virus

Project description:Turnip yellow mosaic virus Raw sequence reads

| PRJNA283239 | ENA

Turnip Yellow Mosaic Virus

Project description:Turnip Yellow Mosaic Virus Raw sequence reads

| PRJNA277612 | ENA

Transcription profiling of Arabidopsis Potyvirus turnip mosaic virus infection stages

Project description:A model system of Potyvirus turnip mosaic virus and Arabidopsis was used in this experiment. GFP-tagged virus supplied a visualized marker for us to localize the viral infection foci and its expansion on leaf under UV light. Initially, we dissect an individual infection focus and its adjacent region into four parts and define those four parts as zone 0, 1, 2, and 3, which represented different viral infection stages respectively. Corresponding fours parts were also dissected from control plant treated with turnip leaf sap only. This process was replicated three times totally.

2006-12-01 | E-MEXP-509 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data