Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

ABSTRACT: AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: Hernan Garcia-Ruiz

PROVIDER: E-GEOD-64911 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Roles and programming of Arabidopsis ARGONAUTE proteins during Turnip mosaic virus infection.

Garcia-Ruiz Hernan H Carbonell Alberto A Hoyer J Steen JS Fahlgren Noah N Gilbert Kerrigan B KB Takeda Atsushi A Giampetruzzi Annalisa A Garcia Ruiz Mayra T MT McGinn Michaela G MG Lowery Nicholas N Martinez Baladejo Maria T MT Carrington James C JC

PLoS pathogens 20150325 3

In eukaryotes, ARGONAUTE proteins (AGOs) associate with microRNAs (miRNAs), short interfering RNAs (siRNAs), and other classes of small RNAs to regulate target RNA or target loci. Viral infection in plants induces a potent and highly specific antiviral RNA silencing response characterized by the formation of virus-derived siRNAs. Arabidopsis thaliana has ten AGO genes of which AGO1, AGO2, and AGO7 have been shown to play roles in antiviral defense. A genetic analysis was used to identify and cha ...[more]

PMID: 25806948

Similar Datasets

Project description:Wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV) are type members of Tritimovirus and Poacevirus genera, respectively, in the family Potyviridae, and are transmitted by wheat curl mites. Co-infection of these two viruses causes synergistic interaction with increased virus accumulation and disease severity in wheat. In this study, we examined the effects of synergistic interaction between WSMV and TriMV on endogenous small (s) RNAs and virus-specific small interfering RNAs (vsiRNAs) in susceptible (Arapahoe) and temperature-sensitive resistant (Mace) wheat cultivars at 27C and 18C. Single- and double-infections in wheat caused a shift in the profile of endogenous sRNAs from 24 nt being the most predominant in healthy plants to 21 nt in infected wheat. Additionally, we report high-resolution vsiRNA maps of WSMV and TriMV in singly- and doubly-infected wheat cultivars Arapahoe and Mace at 18C and 27C. Massive amounts of 21 and 22 nt vsiRNA reads were accumulated in Arapahoe at both temperatures and in Mace at 27C but not at 18C. The plus- and minus-sense vsiRNAs were distributed throughout the genomic RNAs in Arapahoe at both temperature regimens and in Mace at 27C, although some regions of genomic RNAs serve as hot-spots with an excessive number of vsiRNAs. The positions of vsiRNA peaks were conserved among wheat cultivars Arapahoe and Mace, suggesting that Dicer-like enzymes of susceptible and resistant wheat cultivars are similarly accessed the genomic RNAs of WSMV and TriMV. Additionally, several cold-spot regions were found in the genomes of TriMV and WSMV with no or a few vsiRNAs, indicating that certain regions of WSMV and TriMV genomes are not accessible to Dicer-like enzymes. The high-resolution map of endogenous and vsiRNAs from wheat cultivars synergistically infected with WSMV and TriMV at two temperature regimens form a foundation for understanding the virus-host interactions, effect of synergistic interactions on host defense mechanisms, and virus resistance mechanisms in wheat. Small RNA was sequenced from two wheat cultivars (Mace and Araphahoe), at two temperatures 18C and 27C, for healthy (control/uninfected), infected with wheat streak mosaic virus (WSMV), infected with Triticum mosaic virus (TriMV), and a double-infecttion of WSMV and TriMV.

Dataset Information

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Publications

Roles and programming of Arabidopsis ARGONAUTE proteins during Turnip mosaic virus infection.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets