Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

37 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profile of IGROV1 cells after in vitro treatment with CpG-ODN

ABSTRACT: CpG-ODN is a potent immuno-stimulatory molecule. In order to exclude a direct effect of murine CpG-ODN on IGROV1 human ovarian cancer cell line a gene expression experiment was performed. The ovarian cancer cell line IGROV-1 was obtained from the ATCC (Rockville, MD). Cells were routinely maintained in RPMI medium 1640 (Sigma, St. Louis, MO) supplemented with 10% FCS (Sigma) and 2 mM glutamine (Cambrex, East Rutherford, NJ). Cells were maintained at 37°C in a water-saturated atmosphere of 5% CO2 in air. 1x106 IGROV-1 cells were seeded in 6-well plates and, after seeding, cells were treated with 10uM of CpG-ODN in culture medium [phosphorothioated ODN1826 (5’-TCCATGACGTTCCTGACGTT-3’), TriLink Biotechnologies (San Diego, CA, USA)] for 24 hours. At the end of treatment, cells were collected and RNA extracted.

ORGANISM(S): Homo sapiens

SUBMITTER: Loris De Cecco

PROVIDER: E-GEOD-23442 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Gene expression profiling of IGROV1 cells after in vitro treatment with ascitic fluid from human ovarian cancer bearing mice

Project description:CpG-ODN demonstrated anti-tumor activity in IGROV-1 ascites tumor-bearing mice. To evaluate if soluble molecules present in ascitic fluid, presumably released by innate immune cells via TLR9 stimulation, is directly involved with gene expression modulation a microarray experiment was performed. IGROV-1 human ovarian carcinoma cells were adapted to growth intraperitoneally (i.p.) and maintained by serial i.p. passages of ascitic cells into healthy mice as described. Mice were injected i.p. with 2.5 x 106 ascitic cells in 0.2 ml of saline and treated starting 10-11 days later, when mice showed evident and established ascites, with CpG-ODN [phosphorothioated ODN1826 (5’-TCCATGACGTTCCTGACGTT-3’), TriLink Biotechnologies (San Diego, CA, USA)]. Delivered i.p. at a dose of 20 µg/mouse for 3 consecutive days or 1 time, control mice received saline (3 mice/group). Twenty-four hours after the last treatment with saline or CpG-ODN, ascites-bearing mice were sacrificed by cervical dislocation. Ascitic fluid was collected using a heparinized syringe and the volume recorded. The fluid was transferred to a centrifuge tube maintained on ice. After centrifugation, supernatant was removed and stored at -80°C for in vitro experiments. The ovarian cancer cell line IGROV-1 was obtained from the ATCC (Rockville, MD). Cells were routinely maintained in RPMI medium 1640 (Sigma, St. Louis, MO) supplemented with 10% FCS (Sigma) and 2 mM glutamine (Cambrex, East Rutherford, NJ). Cells were maintained at 37°C in a water-saturated atmosphere of 5% CO2 in air. 1x106 IGROV-1 cells were seeded in 6-well plates and, after seeding, cells were treated with 2 ml of culture medium in the presence of ascites from saline-treated mice or CpG-ODN-treated mice (ratio medium:ascites, 1:1) for 24 hours. At the end of treatment, cells were collected and RNA extracted.

2011-04-01 | E-GEOD-23440 | biostudies-arrayexpress

IGROV1 gene expression analysis after in vivo locoregional treatment with CpG-ODN

Project description:Toll-like receptor 9 synthetic agonist oligodeoxynucleotides expressing CpG motifs are currently evaluated for their anti-tumor activity, mainly in association with DNA-damaging drugs. Microarray expression analyses of genes implicates in DNA repair on tumor cells from mice treated with CpG-OD, revealed a down-regulation in tumor cells. These findings provide the first time evidence that immune cells upon TLR9 engagement can sensitize cancer cells to DNA damaging chemotherapy. IGROV-1 human ovarian carcinoma cells were adapted to growth intraperitoneally (i.p.) and maintained by serial i.p. passages of ascitic cells into healthy mice as described. Mice were injected i.p. with 2.5 x 106 ascitic cells in 0.2 ml of saline and treated starting 10-11 days later, when mice showed evident and established ascites, with CpG-ODN [phosphorothioated ODN1826 (5’-TCCATGACGTTCCTGACGTT-3’), TriLink Biotechnologies (San Diego, CA, USA)]. delivered i.p. at a dose of 20 µg/mouse for 3 consecutive days or 1 time, control mice received saline (4 mice/group). 24 hours after the last treatment with saline or CpG-ODN, ascites-bearing mice were sacrificed by cervical dislocation. Tumor cells adhered to peritoneal wall were collected and extraction immediately frozen in liquid nitrogen until RNA extraction.

2011-04-01 | E-GEOD-23441 | biostudies-arrayexpress

IGROV1 miRNA expression analysis after in vivo locoregional treatment with CpG-ODN

Project description:We reported that peri-tumoral CpG-ODN treatment, probably activating TLR9-expressing cells present in the tumor microenvironment, sensitized cancer cells to DNA-damaging chemotherapy (Cancer Res 2011 Oct 15;71(20):6382-90). Here, we investigated whether this treatment induces a modulation of miRNAs and their involvement in chemotherapy sensitivity. Twenty miRNAs were found differentially expressed in tumors from CpG-ODN-treated mice versus controls. Evaluation of the role of miR-424, miR-340 and miR-302b on cisplatin sensitivity revealed that ectopic expression of miR-302b (up-modulated in our array) in IGROV1 cells significantly improved cisplatin activity. The identification of miRNAs able to modify sensitivity to chemotherapy treatment will provide an experimental base for its future possible use as a target or tool of specific therapies. IGROV1 human ovarian carcinoma cells were adapted to growth intraperitoneally (i.p.) and maintained by serial i.p. passages of ascitic cells into healthy mice. Mice were injected i.p. with 2.5 x 10^6 ascitic cells in 0.2 ml of saline and treated starting 10-11 days later, when mice showed evident and established ascites, with CpG-ODN [phosphorothioated ODN1826 (5'-TCCATGACGTTCCTGACGTT-3')] delivered i.p. at a dose of 20 µg/mouse for 3 consecutive days, control mice received saline (4 mice/group). 24 hours after the last treatment, ascites-bearing mice were sacrificed. Tumor cells adherent to peritoneal wall were collected and immediately frozen in liquid nitrogen until RNA extraction.

2013-03-31 | E-GEOD-41783 | biostudies-arrayexpress

Gene expression profiling of IGROV1 cells after in vitro treatment with ascitic fluid from human ovarian cancer bearing mice

2011-04-01 | GSE23440 | GEO

Gene expression profile of IGROV1 cells after in vitro treatment with CpG-ODN

Project description:CpG-ODN is a potent immuno-stimulatory molecule. In order to exclude a direct effect of murine CpG-ODN on IGROV1 human ovarian cancer cell line a gene expression experiment was performed.

2011-04-01 | GSE23442 | GEO

Gene expression profile of IGROV1 cells after treatment of saline or CpG-ODN

Project description:This SuperSeries is composed of the following subset Series: GSE23440: Gene expression profiling of IGROV1 cells after in vitro treatment with ascitic fluid from human ovarian cancer bearing mice GSE23441: IGROV1 gene expression analysis after in vivo locoregional treatment with CpG-ODN GSE23442: Gene expression profile of IGROV1 cells after in vitro treatment with CpG-ODN Refer to individual Series

2011-04-01 | E-GEOD-23491 | biostudies-arrayexpress

IGROV1 miRNA expression analysis after in vivo locoregional treatment with CpG-ODN

2013-03-31 | GSE41783 | GEO

Suppression of TLR9-dependent gene expression in vivo mediated by TTAGGG motifs

Project description:Immunostimulatory CpG ODN trigger an innate immune response characterized by the rapid production of pro-inflammatory cytokines and chemokines, an effect that persists for days to weeks in vivo. Previous studies established that gene up-regulation is maximal 3 hr after CpG ODN treatment of normal mice {Klaschik et al. JLB 2009}. The immunostimulatory activity of CpG ODN is blocked by the addition of immunosuppressive ODN expressing multiple TTAGGG motifs. To clarify the mechanism underlying this suppression, changes in gene expresssion were evaluated by microarray in mice treated with 400 ìg of CpG ODN + 400 ìg of suppressive ODN.

2011-06-01 | GSE22156 | GEO

Gene expression profiling after RNA interference of CXCR4 in human ovarian cancer cell line IGROV-1.

Project description:In the past three years the role of inflammatory cytokines and chemokines in tumour promotion and progression has been intensively studied. The chemokine receptor CXCR4 and its ligand CXCL12 are commonly expressed in malignant cells from primary tumours, metastases and also in malignant cell lines. To investigate the biological significance of this receptor/ligand pair, we knocked-down CXCR4 expression in ovarian cancer cell line IGROV-1 using shRNA, and established stable cell lines. Using Affymetrix microarrays we compared in vitro gene expression in parental IGROV-1 and IGROV-Mock cells with two clones of IGROV-shCXCR4 cells. Gene Set Enrichment Analysis (GSEA) of those genes which were altered by RNA interference of CXCR4 revealed evidence for a cell autonomous signaling network involving CXCR4, TNF-a, IL6 and Notch pathways in ovarian cancer cells. Keywords: Affymetrix GeneChip Human Genome U133Plus 2.0

2008-11-29 | GSE13763 | GEO

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data