Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

ABSTRACT: In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

ORGANISM(S): Anopheles gambiae

SUBMITTER: Henrique Silveira

PROVIDER: E-GEOD-26941 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:Mosquitoes possess an innate immune system that is capable of limiting infection by a variety of pathogens, including the Plasmodium spp. parasites responsible for human malaria. The Anopheles immune deficiency (IMD) innate immune signaling pathway confers resistance to Plasmodium falciparum. While some previously identified Anopheles anti-Plasmodium effectors are regulated through signaling by Rel2, the transcription factor of the IMD pathway, many components of this defense system remain uncharacterized. To begin to better understand the regulation of immune effector proteins by the IMD pathway, we used oligonucleotide microarrays and iTRAQ to analyze differences in mRNA and protein expression, respectively, between transgenic An. stephensi mosquitoes exhibiting blood meal-inducible overexpression of an active recombinant Rel2 and their wild-type conspecifics. Numerous genes were differentially regulated at both the mRNA and protein levels following induction of Rel2. While multiple immune genes were up-regulated, a majority of the differentially expressed genes have no known immune function in mosquitoes. Identified sequences were assigned putative functions and gene ontology (GO) terms based on homology to previously annotated A. gambiae gene sequences. Selected up-regulated genes from multiple GO categories were tested for both anti-Plasmodium and anti-bacterial action using RNA interference (RNAi). Based on our experimental findings, we conclude that increased expression of the IMD immune pathway-controlled transcription factor Rel2 affects the expression of numerous genes with diverse functions, suggesting a broader physiological impact of immune activation and possible functional versatility of Rel2. Our study has identified multiple novel anti-Plasmodium effectors. Midguts from midgut-specific transgenic A. stephensi at 6 and 12 hours post-blood meal and fat bodies from fat body-specific transgenic A. stephensi at 12 and 18 hours post-blood meal were compared to wild-type A. stephensi at the same time points. 3 biological replicates and 1 pseudo-replicate per array.

Project description:The mosquito Anopheles gambiae uses its innate immune system to control bacterial and Plasmodium infection of its midgut tissue. The activation of potent IMD pathway-mediated anti-Plasmodium falciparum defenses is dependent on the presence of the midgut microbiota, which activate this defense system upon parasite infection through a peptidoglycan recognition protein, PGRPLC. We employed transcriptomic and reverse genetic analyses to compare the P. falciparum infection-responsive transcriptomes of septic and aseptic mosquitoes and to determine whether bacteria-independent anti-Plasmodium defenses exist. To examine the impact of P. falciparum infection on the mosquito midgut and carcass transcriptomes in the presence or absence of midgut bacteria, we used A. gambiae whole genome microarrays to compare the mRNA abundance of P. falciparum-infected and -naÃ¯ve mosquitoes of antibiotic- and non-antibiotic treated cohorts. P. falciparum infection induced changes in the abundance of as many as 2,183 and 2,429 transcripts in whole mosquitoes belonging to a variety of functional groups in aseptic and septic mosquitoes. Ultimately, we were interested in identifying the genes involved in bacteria-independent anti-Plasmodium responses, and therefore we focused on transcripts displaying increased abundance in the parasite-infected aseptic midguts, placing a particular emphasis on those with predicted immune functions. Because of the central role of serine protease cascades in regulating insect immune defenses, we focused the remainder of our analysis on a clip-domain serine protease C2 (CLIPC2, AGAP004317) and a serine protease inhibitor 7 (SRPN7, AGAP007693) that were specifically upregulated in the parasite-infected, aseptic mosquito midgut. We showed that SRPN7 negatively and CLIPC2 positively regulate the anti-Plasmodium defense, independently of the midgut-associated bacteria. Co-silencing assays suggested that these two genes may function together in a signaling cascade. Neither gene was regulated, nor modulated, by infection with the rodent malaria parasite Plasmodium berghei, suggesting that SRPN7 and CLIPC2 are components of a defense system with preferential activity towards P. falciparum. Further analysis using RNA interference determined that these genes do not regulate the anti-Plasmodium defense mediated by the IMD pathway, and both factors act as agonists of the endogenous midgut microbiota, further demonstrating the lack of functional relatedness between these genes and the bacteria-dependent activation of the IMD pathway. This is the first study confirming the existence of a bacteria-independent, anti-P. falciparum defense. Aseptic and septic midguts and carcasses from P. falciparum-infected A. gambiae vs aseptic and septic midguts and carcasses from uninfected, blood-fed A. gambiae. 3 biological replicates and 1 pseudo-replicate per each array.

Project description:Malaria is caused by Plasmodium parasites, which are transmitted via the bites of infected Anopheline mosquitoes. Midgut invasion is a major bottleneck for Plasmodium development inside the mosquito vectors as a rapidly responding immune system recognizes ookinetes and recruits killing factors from the midgut and surrounding tissues, dramatically reducing the population of invading ookinetes before they can successfully traverse the midgut epithelium. Understanding molecular details of the parasite-vector interactions requires precise measurement of nascent protein synthesis in the mosquito during Plasmodium infection. Current expression profiling primarily monitors alterations in steady-state levels of mRNA, but does not address the equally critical issue of whether the proteins encoded by the mRNAs are actually synthesized. In this study, we used sucrose density gradient centrifugation to isolate actively translating Anopheles gambiae mRNAs based upon their association with polyribosomes (polysomes). The proportion of individual gene transcripts associated with polysomes, which is determined by RNA deep sequencing, reflects mRNA translational status. This approach led to identification of 1017 mosquito transcripts that were primarily regulated at the translational level after ingestion of Plasmodium falciparum-infected blood. Caspar, a negative regulator of the NF-kappaB transcription factor Rel2, appears to be substantially activated at the translational levels during Plasmodium infection. In addition, transcripts of Dcr1, Dcr2 and Drosha, which are involved in small RNA biosynthesis, exhibited enhanced associations with polysomes after P. falciparum challenge. This observation suggests that mosquito microRNAs may play an important role in reactions against Plasmodium invasion. We analyzed both total cellular mRNAs and mRNAs that are associated with polysomes to simultaneously monitor transcriptomes and nascent protein synthesis in the mosquito. This approach provides more accurate information regarding the rate of protein synthesis, and identifies some mosquito factors that might have gone unrecognized because expression of these proteins is regulated mainly at the translational level rather than at the transcriptional level after mosquitoes ingest a Plasmodium-infected blood meal. Midguts from female Anopheles gambiae mosquitoes were dissected at around 24 h after ingestion of P. falciparum-infected blood. Mosquitoes fed on uninfected blood were used as control. A portion of the midguts were used for isolation of total cellular RNA. Extracts of the remaining midguts were fractionated over sucrose density gradients, and fifteen fractions were collected from the top of each gradient. Non-polysomal fractions, as well as polysomal fractions were combined, respectively, to obtain two RNA pools per gradient for three independent experiments. The first, last and the sample between non-polysomal and polysomal, were all discarded to ensure pure pools from each set. A fourth experiment was conducted where the polysomal and non-polysomal samples were not pooled, to be used later for qRT-PCR. The mRNA levels of individual mosquito genes in polysome (PS) fractions, nonpolysome (NP) fractions and unfractionated steady-state (total) RNA were determined using high throughput RNA deep sequencing. Each RNA pool generated 2.1-9.8 million raw read . Signal intensities of transcripts from each PS pool were compared to those of transcripts from a matching NP pool. To quantify the translational status of individual mRNA species, we define the relative PS loading [PL=P/(P+NP)] as the extent of mRNA association with polysomes. PL values were compared between the mosquitoes fed on P. falciparum-infected or -uninfected blood.

Dataset Information

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets