Hypermethylation of miR-34b is associated with CREB overexpression and Myeloid Cell Transformation
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: silvia bresolin
PROVIDER: E-GEOD-25300 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Publications
MicroRNA-34b promoter hypermethylation induces CREB overexpression and contributes to myeloid transformation.
Pigazzi Martina M Manara Elena E Bresolin Silvia S Tregnago Claudia C Beghin Alessandra A Baron Emma E Giarin Emanuela E Cho Er-Chieh EC Masetti Riccardo R Rao Dinesh S DS Sakamoto Kathleen M KM Basso Giuseppe G
Haematologica 20121025 4
MicroRNA-34b down-regulation in acute myeloid leukemia was previously shown to induce CREB overexpression, thereby causing leukemia proliferation in vitro and in vivo. The role of microRNA-34b and CREB in patients with myeloid malignancies has never been evaluated. We examined microRNA-34b expression and the methylation status of its promoter in cells from patients diagnosed with myeloid malignancies. We used gene expression profiling to identify signatures of myeloid transformation. We establis ...[more]
Similar Datasets
Project description:Increased CREB levels and upregulation of its target genes expression resulted in increased myelopoiesis and colony formation.
2012-11-30 | GSE25300 | GEO
Project description:Identification of relevant subgroups in childhood MDS patients by gene expression analysis and gene involve in progression into AML Class comparison between different subgroups of pediatric MDS (class risk, classification subtype)
2012-02-29 | E-GEOD-29326 | biostudies-arrayexpress
Project description:MicroRNA-34b down-regulation in acute myeloid leukemia was previously shown to induce CREB overexpression, thereby causing leukemia proliferation in vitro and in vivo. The role of microRNA-34b and CREB in patients with myeloid malignancies has never been evaluated. We examined microRNA-34b expression and the methylation status of its promoter in cells from patients diagnosed with myeloid malignancies. We used gene expression profiling to identify signatures of myeloid transformation. We established that microRNA-34b has suppressor ability and that CREB has oncogenic potential in primary bone marrow cell cultures and in vivo. MicroRNA-34b was found to be up-regulated in pediatric patients with juvenile myelomonocytic leukemia (n=17) and myelodysplastic syndromes (n=28), but was down-regulated in acute myeloid leukemia patients at diagnosis (n=112). Our results showed that hypermethylation of the microRNA-34b promoter occurred in 66% of cases of acute myeloid leukemia explaining the low microRNA-34b levels and CREB overexpression, whereas preleukemic myelodysplastic syndromes and juvenile myelomonocytic leukemia were not associated with hypermethylation or CREB overexpression. In paired samples taken from the same patients when they had myelodysplastic syndrome and again during the subsequent acute myeloid leukemia, we confirmed microRNA-34b promoter hypermethylation at leukemia onset, with 103 CREB target genes differentially expressed between the two disease stages. This subset of CREB targets was confirmed to associate with high-risk myelodysplastic syndromes in a separate cohort of patients (n=20). Seventy-eight of these 103 CREB targets were also differentially expressed between healthy samples (n=11) and de novo acute myeloid leukemia (n=72). Further, low microRNA-34b and high CREB expression levels induced aberrant myelopoiesis through CREB-dependent pathways in vitro and in vivo. In conclusion, we suggest that microRNA-34b controls CREB expression and contributes to myeloid transformation from both healthy bone marrow and myelodysplastic syndromes. We identified a subset of CREB target genes that represents a novel transcriptional network that may control myeloid transformation.
| S-EPMC3659992 | biostudies-literature
Project description:Gene expression analysis identified a specific signature of differentially expressed genes discriminating good and poor responders in JMML patients. Gene expression signatures were analyzed on two EWOG patient cohorts of pediatric JMML patients. Keywords: Expression data Class comparison between AML-like vs non-AML-like signatures in JMML patients.
2009-12-31 | E-GEOD-14858 | biostudies-arrayexpress
Project description:The cAMP responsive element binding protein (CREB) pathway has been involved in two major cascades of gene expression regulating neuronal function. The first one presents CREB as a critical component of the molecular switch that control longlasting forms of neuronal plasticity and learning. The second one relates CREB to neuronal survival and protection. To investigate the role of CREB-dependent gene expression in neuronal plasticity and survival in vivo, we generated bitransgenic mice expressing A-CREB, an artificial peptide with strong and broad inhibitory effect on the CREB family, in forebrain neurons in a regulatable manner. The expression of ACREB in hippocampal neurons impaired L-LTP, reduced intrinsic excitability and the susceptibility to induced seizures, and altered both basal and activity-driven gene expression. In the long-term, the chronic inhibition of CREB function caused severe loss of neurons in the CA1 subfield as well as in other brain regions. Our experiments confirmed previous findings in CREB deficient mutants and revealed new aspects of CREB-dependent gene expression in the hippocampus supporting a dual role for CREB-dependent gene expression regulating intrinsic and synaptic plasticity and promoting neuronal survival. manufacturer's protocol. Experiment Overall Design: Each sample contained total RNA from the hippocampi of a group of 3-4 three weeks old mice. We obtained duplicate samples for each experimental condition (in total 14 WT and 20 A-CREB mice where used in this experiment). Mouse Genome 430 2.0 genechips were hybridized, stained, washed and screened for quality according to the manufacturer's protocol.
2009-01-17 | E-GEOD-14320 | biostudies-arrayexpress
Project description:The aim is to identify transcripts which are differentially regulated upon the duxycline-controlled induction of a transcription factor, CREB-H.<br>A cell line was developed 293.CREB-H which contains this factor under th etight control of a doxycline rwgukated activator suhc that after doxycline treatment, CREB-H is induced, and then this factor will act upon cellular target genes. These will be identiifed by comparing the profile in th esame cells before and after doxycline treatment<br>
2010-12-09 | E-MEXP-3004 | biostudies-arrayexpress
Project description:Hepatocarcinoma is the third leading cause of death in cancer in the world. In recent years, research on CREB in hepatocellular carcinoma has become a hotspot, so our research group wants to use the mass spectrometry analysis what proteins can bind with CREB, and then explore the links between CREB and hepatocellular carcinoma.
2019-11-08 | PXD008261 | Pride
Project description:Gene expression analysis identified a specific signature of differentially expressed genes discriminating TTLshort and TTLlong phenotypes. Gene expression signatures of xenografted leukemia samples with different TTL phenotypes were analyzed on cohorts of pediatric BCP-ALL patients. Class comparison between TTLshort and TTLlong patient groups was analyzed by shrinkage t statistic.
2011-02-10 | E-GEOD-13576 | biostudies-arrayexpress
Project description:We compare here the neurodegenerative processes observed in the hippocampus of bitransgenic mice with chronically altered levels of cAMP-response element-binding protein (CREB) function. The combination of genome-wide transcriptional profiling of degenerating hippocampal tissue with microscopy analyses reveals that the sustained inhibition of CREB function in A-CREB mice is associated with dark neuron degeneration, whereas its strong chronic activation in VP16-CREB mice primarily causes excitotoxic cell death and inflammation. Furthermore, the meta-analysis with gene expression profiles available in public databases identifies relevant common markers to other neurodegenerative processes and highlights the importance of the immune response in neurodegeneration. Overall, these analyses define the ultrastructural and transcriptional signatures associated with these two forms of hippocampal neurodegeneration, confirm the importance of fine-tuned regulation of CREBdependent gene expression for CA1 neuron survival and function, and provide novel insight into the function of CREB in the etiology of neurodegenerative processes. For each mouse genome 430 2.0 gene expression array (Affymetrix, Santa Clara, CA, USA), total RNA was extracted from the hippocampi of three to four mice with the same age, sex, and genotype to produce one pooled sample. We analyzed three late A-CREB pooled samples (6-week-old mice) and three late VP16-CREB pooled samples (3-week-off dox) with their corresponding control littermate samples (three pooled samples for each strain). To compare with early changes, we included two pooled A-CREB early samples (3-week-old mice) and two pooled VP16-CREB early samples (1-week-off dox) with their corresponding control littermate samples. In the case of A-CREB mice, we used the dataset GSE14320. We prepared new samples from bitransgenic mice and control littermates 1 week after transgene induction and hybridized them to mouse genome 430 2.0 genechips. The arrays were hybridized, washed, and screened for quality according to the manufacturerâs protocol.
2010-04-28 | E-GEOD-21137 | biostudies-arrayexpress
Project description:Background. The cAMP Response Element Binding Protein, CREB, is a transcription factor that regulates cell proliferation, differentiation, and survival in several model systems, including neuronal and hematopoietic cells. We demonstrated that CREB is overexpressed in acute myeloid and leukemia cells compared to normal hematopoietic stem cells. CREB knockdown inhibits leukemic cell proliferation in vitro and in vivo, but does not affect long-term hematopoietic reconstitution. Therefore, we propose CREB to be a potential target for therapy. To understand downstream pathways regulating CREB, we performed expression profiling with RNA from the K562 myeloid leukemia cell line. Results. By combining our expression data from CREB knockdown cells with prior ChIP data on CREB binding we were able to identify a list of putative CREB regulated genes. We performed extensive analyses on the top genes in this list as high confidence CREB targets. We found that this list is enriched for genes involved in cancer, and unexpectedly, highly enriched for histone genes. Furthermore, histone genes regulated by CREB were more likely to be specifically expressed in hematopoietic lineages. The transcription factor Elk-1 was upregulated in response to CREB deletion. Conclusions. We have identified a high confidence list of CREB targets in K562 cells. These genes allow us to begin to understand the mechanisms by which CREB contributes to acute leukemia. In particular, we speculate that the regulation of histone genes may play an important role in this process, by possibly altering the regulation of DNA replication during the cell cycle. Experiment Overall Design: Cell lines. The following human leukemia cell lines were transduced with shRNAs: K562 (Iscoves + 10% FCS) and TF-1 (RPMI + 10%FCS + rhGM-CSF. Cells were cultured at 37oC, 5% CO2 and split every 3 to 4 days. Primary AML bone marrow samples were processed as previously described [12]. All human samples were obtained with approval from the Institutional Review Board and consents were signed, according to the Helsinki protocol. Experiment Overall Design: shRNA sequence design and constructs. The CREB specific shRNA sequences were selected and validated based on accepted parameters established by Tuschl et al. [25-27]; CREB shRNA-1, CREB shRNA-2, CREB shRNA-3. Controls included empty vector, luciferase shRNA, and scrambled shRNA. shRNA sequences are: CREB shRNA-1(5âGCAAATGACAGTTCAAGCCC3â), shRNA-2 (5âGTACAGCTGGCTAACAATGG3â), shRNA-3 (5âGAGAGAGGTCCGTCTAATG3â), Luciferase shRNA (5âGCCATTCTATCCTCTAGAGGA3â), Scramble shRNA (5âGGACGAACCTGCTGAGATAT3â). Short-hairpin sequences were synthesized as oligonucleotides and annealed according to standard protocol. Annealed shRNAs were then subcloned into pSICO-R shRNA vectors from the Jacks laboratory at MIT [28]. The second generation SIN vector HIV-CSCG was used to produce human shRNA vectors [29]. Experiment Overall Design: Microarray analysis. Total RNA (10 μg) was extracted from K562 cells transduced with vector alone or CREB shRNA was submitted to the UCLA DNA Microarray Facility. RNA samples were labeled and hybridized by standard protocol to Affymetrix GeneChip Human Genome U133+ Array Set HG-U133A array. Gene expression values were calculated using the MAS5 software. The expression values are quantile normalized across all arrays. We obtained the expression profiles for a control set and CREB downregulated K562 cells. These are first quantile normalized, and then a t-test is performed between the two groups to identify significantly differentially regulated genes. The analysis was performed using Matlab (Mathworks, Inc.). A normal quantile plot of T is shown in figure qqplot.tiff. Data points with t-scores < 1/(2N) display with red circles, were N is the total number of genes. We therefore see that there are a significant number of differentially expressed genes, which are either direct or indirect targets of CREB.
2008-10-25 | E-GEOD-12056 | biostudies-arrayexpress