Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Glycogene expression changes between different passages in the 4T1 Mouse metastatic breast cancer cell line

ABSTRACT: This laboratory's focus is on the immune response to carbohydrate antigens, with an emphasis on modalities to analyze and to increase the immune response. We are also interested in carbohydrate drug targeting. The hypothesis is that these 2 variants have different cell surface carbohydrate expression, which results in different adhesion patterns, which ultimately results in different metastasis patterns. Evidence for expression differences and loss of the variants ability to metastasize to the lung could have clinical implications in the prevention of metastasis to different organs. The 4T1 mouse metastatic breast cancer cell line is known to change with passages in culture. Our data has shown changes cause the cells to metastasize to the intestine rather than to the lung. Four classes of RNA were analyzed: one each from 4T1 metastatic cell line variant #1, 4T1 variant #2, non-metastatic cell lines 4T07, and non-metastatic cell line 67NR. Classes were prepared in triplicate for a total of 12 samples. All samples were hybridized to the custom designed CFG GLYCOv2 glycogene array.

ORGANISM(S): Mus musculus

SUBMITTER: Steven Head

PROVIDER: E-GEOD-27354 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Glycogene expression changes between different passages in the 4T1 Mouse metastatic breast cancer cell line

Project description:This laboratory's focus is on the immune response to carbohydrate antigens, with an emphasis on modalities to analyze and to increase the immune response. We are also interested in carbohydrate drug targeting. The hypothesis is that these 2 variants have different cell surface carbohydrate expression, which results in different adhesion patterns, which ultimately results in different metastasis patterns. Evidence for expression differences and loss of the variants ability to metastasize to the lung could have clinical implications in the prevention of metastasis to different organs.

2011-02-17 | GSE27354 | GEO

Transcription profiling of mouse BALB/c strain animals injected with breast cancer 4T1-derived cells to investigate the role of epithelial to mesenchymal transition (EMT) in spontaneous breast cancer metastasis

Project description:Epithelial-mesenchymal transition (EMT) has been linked to cancer progression and metastatic propensity. The 4T1 tumor is a clinically relevant model of spontaneous breast cancer metastasis. Here we characterize 4T1-derived cell lines for EMT, in vitro invasiveness and in vivo metastatic ability. Contrary to expectations, the 67NR cells, which form primary tumors but fail to metastasize, express vimentin and N-cadherin, but not E-cadherin. 4T1 cells, however, express E-cadherin, are highly migratory and invasive, and metastasize to multiple sites. The 66cl4 metastatic cells display mixed epithelial and mesenchymal markers, but are less migratory and invasive than 67NR cells. These findings demonstrate that the metastatic ability of breast cancer cells does not correlate with genotypic and phenotypic properties of EMT per se, and suggest that other processes may govern metastatic capability. Gene expression analysis also has not identified differences in EMT markers, but has identified several candidate genes that may influence metastatic ability. Experiment Overall Design: Female BALB/c mice were injected with 1x10^6 viable cells (3 mice with 4T1/CMVLUC, 3 mice with 66cl4/CMVLUC, and 3 mice with 67NR/CMVLUC) into the right fourth mammary gland. 15 days after injection primary tumors were excised, and total RNA for microarray hybridization was isolated from the tumor part of laser capture microdissected sections.

2009-03-07 | E-GEOD-11259 | biostudies-arrayexpress

Role of epithelial to mesenchymal transition (EMT) in spontaneous breast cancer metastasis

2008-08-01 | GSE11259 | GEO

KLF17 is a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer

Project description:Metastasis is a complex multi-step process requiring the concerted action of many genes and is the primary cause of cancer deaths. Pathways that regulate metastasis enhancement and suppression both contribute to tumor dissemination process. In order to identify novel metastasis suppressors, we set up a forward genetic screen in a mouse model. We transduced a genome-wide RNAi library into the non-metastatic 168FARN breast cancer cell line, orthotopically transplanted the cells into mouse mammary fat pads, and then selected for cells that could metastasize to the lung and identified an RNAi for the KLF17 gene. Conversely, ectopic expression of KLF17 in highly metastatic 4T1 breast cancer cell line inhibited their ability to metastasize from the mammary fat pad to the lung. We showed that suppression of KLF17 expression promotes breast cancer cell invasion and epithelial-mesenchymal transition (EMT). We also showed that KLF17 functions by directly binding to the promoter of Id-1, a key metastasis regulator in breast cancer, to inhibit its transcription. Finally, we demonstrated that KLF17 expression is significantly down-regulated in primary human breast cancer samples and that the combined expression patterns of KLF17 and Id-1 can serve as a potential biomarker for lymph node metastasis in breast cancer.

2009-11-30 | GSE17081 | GEO

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

gene expression profiling of brain metastatic melanoma cell lines

Project description:Cerebral metastases occur in a majority of metastatic melanoma patients and are a major cause of mortality. Despite this, there is a poor understanding of the molecules/pathways that lead to the brain-metastatic phenotype. Studies designed to address this deficiency and test novel therapeutic approaches have until recently been slowed by an absence of preclinical models of spontaneous CNS metastatic melanoma disease. To address this, we isolated two variants of the human melanoma cell line WM239 (named 131/4-5B1 and 131/4-5B2) which can metastasize spontaneously to brain parenchyma from an orthotopic primary transplant. We have performed gene expression profiling on both brain metastatic cell lines (131/4-5B1 and 131/4-5B2) and compared to the poorly metastatic parental cell line WM239A and a derived highly metastatic variant 113/6-4L in order to examine the mechanisms that influence the progression of malignant melanoma to a brain-metastatic phenotype. Two-condition experiment, brain metastatic cell lines (131/4-5B1 and 131/4-5B2) and compared to the poorly metastatic parental cell line WM239A and a derived highly metastatic variant 113/6-4L. Biological replicates: 4 independently grown and harvested cell line passages. Two technical replicate per condition (including dye swap).

2012-11-21 | E-GEOD-23601 | biostudies-arrayexpress

Development and characterization of a clinically relevant model of breast cancer brain metastasis

Project description:Breast cancer brain metastasis remains largely incurable. While several mouse models have been developed to investigate the genes and mechanisms regulating breast cancer brain metastasis, these models often lack clinical relevance since they require the use of immune-compromised mice and/or are poorly metastatic to brain from the mammary gland. We describe the development and characterization of an aggressive brain metastatic variant of the 4T1 syngeneic model (4T1Br4) that spontaneously metastasises to lung, bone and brain but is selectively more metastatic to the brain from the mammary gland than parental 4T1 tumors. The 4T1Br4 model will provide a clinically relevant tool to evaluate novel therapies against brain metastasis.

2018-07-03 | GSE111489 | GEO

Signature of CD45- metastatic niche cells at different stages of the metastatic disease

Project description:We analysed the signature of the non-immune cells from the metastatic niche and the distal lung using the breast tumour 4T1 cell line as a model of lung metastasis from breast cancer

2019-08-28 | GSE117930 | GEO

Expression data from 4T1 subclones derived from mammary fat pad tumors (MFP), axillary lymph node tumors (AxLN), and axillary lymph node-derived lung metastases (AxLN-LuM)

Project description:Expression data from 4T1 subclones derived from mammary fat pad tumors (MFP), axillary lymph node tumors (AxLN), and axillary lymph node-derived lung metastases (AxLN-LuM). In parallel, expression data, in the same subclones, of tail vein-derived (TV) lung metastases. The mechanism of how lymph node metastases seed distant metastases is unknown. We used the 4T1 breast cancer cell line, which is an immune competent model of triple negative breast cancer and spontaneously metastasizes in balb/c mice. 4T1-GFP/fLuc cells were injected into MFP to form tumors and 4T1-mCherry/rLuc cells were injected into axillary lymph nodes to form tumors and then allowed to metastasize to lung. TV cells were allowed to metastasize in the lung. Cells were harvested at different time intervals after the injection. Tumors were extracted, dissociated, and then expanded in vitro to obtain MFP, AxLN, AxLN-LuM and TV-LuM subclones isolated after different time lags with respect to the injection.

2019-08-20 | GSE136031 | GEO

gene expression profiling of brain metastatic melanoma cell lines

2012-11-21 | GSE23601 | GEO