Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools
Ontology highlight
ABSTRACT: Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.
ORGANISM(S): Mus musculus
PROVIDER: GSE202685 | GEO | 2023/12/18
REPOSITORIES: GEO
ACCESS DATA