Dataset Information

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

ABSTRACT: Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

ORGANISM(S): Mus musculus

PROVIDER: GSE202685 | GEO | 2023/12/18

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:Novel therapies targeting cancer stem cells (CSCs), which play critical roles in chemo- and radio-resistance, metastasis, and possibly resistance against cancer immunotherapy including granulocyte-macrophage colony-stimulating factor (GM-CSF) gene-transduced tumor cell vaccines, may provide beneficial clinical outcomes. Here, we used syngeneic immunocompetent mice that allowed precise evaluation of the immunogenicity of the side population (SP) isolated from 4T1 murine breast carcinoma (4T1-SP) cells as putative CSCs. 4T1-SP cells showed various stem cell properties including high capacities for colony formation and tumorigenicity as well as high expression of phosphorylated signal transducer and activator of transcription-3 and vascular endothelial growth factor that are inductive of immune tolerance. Despite these progressive malignant characteristics of 4T1-SP cells, subcutaneous injection of non-transmissible Sendai virus-mediated GM-CSF gene-transduced 4T1-SP (4T1-SP/GM) cells remarkably impaired their tumorigenicity compared with that of the controls. This impairment of tumorigenicity was partially dependent on CD8+ T cells in concert with CD4+ T cells and natural killer cells. Notably, therapeutic vaccinations using irradiated 4T1-SP/GM cells markedly suppressed tumor development of subcutaneously transplanted 4T1-SP cells compared with that of the controls including irradiated 4T1-non-SP/GM cells. Tumor suppression was accompanied by robust accumulation of mature dendritic cells at vaccination sites and systemic Th1-based cellular immunity. Moreover, vaccinations comprising primary 4T1-SP cells isolated from transplanted 4T1-SP tumors elicited antitumor effects. cDNA microarray analysis showed that 4T1-SP cells predominantly expressed genes of cancer-related antigens including cancer/testis antigens. Collectively, we demonstrate that SP cell-based vaccinations induce effective antitumor immunity that may improve the efficacy of SP cell-based immunotherapy. Gene expression profiles were compared between sorted 4T1-SP and 4T1-NSP cells.

Dataset Information

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets