Transcriptional profile of Pseudomonas syringae pv phaseolicola at low temperature
Ontology highlight
ABSTRACT:
ORGANISM(S): Pseudomonas syringae pv. phaseolicola
SUBMITTER: Jose Luis Hernandez-Flores
PROVIDER: E-GEOD-38423 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:P. syringae pv. phaseolicola is the causal agent of the halo blight disease of beans (Phaseolus vulgaris L). The disease attacks both foliage and pods of plant host. Many genes involve in pathogenicity and virulence are induced only in plant or in the presence of host components. In this work we investigated the effect of bean pod extract on the transcriptomic profile of the bacterium, when grown at low temperature in minimal medium with or without bean pod extract. Two RNA samples were compared, one prepared from cells grown in minimal medium M9 and the other from cells grown in minimal medium supplemented with bean pod extract.To control de biological variation that might interfere with data interpretation, a minimum of three biological replicates and two technical replicates (swap) were prepared.
2010-05-22 | E-GEOD-14625 | biostudies-arrayexpress
Project description:Pseudomonas syringae pv. phaseolicola is the causal agent of halo blight disease of beans (Phaseolus vulgaris L.), which is characterized by water-soaked lesions surrounded by a chlorotic halo resulting from the action of a non-host-specific toxin known as phaseolotoxin, that inhibits the enzyme ornithine carbamoyltransferase involved in the arginine biosynthesis pathway. It was previously reported that genes within the Pht cluster were involved in the regulation and synthesis of phaseolotoxin. The GacS/GacA two component signal transduction system controls important pathogenicity and virulence mechanisms in several Gram-negative bacteria. In the present study we hybridized a genomic microarray of P. syringae pv. phaseolicola NPS3121 to compare transcriptional profiles from wild type strain and a gacA- null mutant with a Tox- 11 phenotype. Results show that GacA controls expression of genes within the Pht cluster as well as another group of clustered genes located in a 13 different region in the bacterial chromosome that contains at least one gene unambiguously shown to be directly involved in phaseolotoxin biosynthesis. Results suggest that this cluster is a new pathogenicity island containing genes whose regulation is also under GacA regulatory cascade and it will require further investigation to determine gene functions and their relationship to virulence mechanisms Transcriptional profiles of a P. syringae pv. phaseolicola NPS3121 null gacA mutant were compared to those of the wild-type strain. Cultures were grown in minimal medium at 18°C (which is the temperature at which phaseolotoxin is produced and the bacteria achieves full virulence) and harvested during the late log phase of the exponential growth. RNA from three biological replicates and each with two technical replicates were hybridize to control variation that might affect data interpretation.
2010-05-16 | E-GEOD-16632 | biostudies-arrayexpress
Project description:P. syringae pv. phaseolicola, the causal agent of halo blight disease in bean, produces a toxin known as phaseolotoxin, whose synthesis involves the product of some of the genes found within the Pht region. This region, considered a pathogenicity island, comprises 23 genes arranged in five transcriptional units; two single-gene units (argK, phtL) and three arranged as operons (phtA, phtD, phtM), most with unknown function. In P. syringae pv. phaseolicola, maximal expression of most of the genes encoded in the Pht region and the synthesis of phaseolotoxin require the product of the phtL gene, which has been proposed to have a regulatory function. In order to evaluate the role of phtL gene in P. syringae pv. phaseolicola, we performed a comparative transcriptional analysis with the wild type and a phtL- mutant strains using microarrays. The microarray data analysis showed that PhtL regulates the expression not only of genes within the Pht region, but also alters the expression of genomic genes related with the iron-acquisition system, pathogenicity, oxidative stress and virulence. This study suggests the possible relation of the PhtL protein with the iron response genes and with the pathogenicity and or virulence of this bacterium. The microarrays used in this study correspond to an assembled DNA microarray of P. syringae pv. phaseolicola NPS3121 previously reported (GEO accession number GPL7115) (HernM-CM-!ndez-Morales et al., 2009). This microarray consist of 1911 probes, with an average length 2.4 Kbp, representing 1X the genome of P. syringae pv. phaseolicola NPS3121, as well as several PCR products corresponding to various known genes, which were printed as controls. Each microarray experiment was repeated six times (two technical replicates with the same RNA samples and three biological replicates using RNA isolated from a different culture). cDNA synthesis, labeling, hybridization, washing, and chip scanning were performed at the Microarray Core Facility at Cinvestav-Langebio. Hybridized microarray slides were scanned (GenePix 4000, Axon Instruments, Inc) at a 10 um resolution adjusting the laser and gain parameters to obtain similar levels of fluorescence intensity in both channels. The spot intensities were quantified using Axon GenePrix Pro 6.0 image analysis software. First, an automatic spot finding and quantification option of the software was used. Subsequently, all spots were inspected individually and in some cases, the spot diameters were corrected or the spots were removed from the analysis. The mean of the signals and the median of backgrounds were used for further analysis. Raw data were imported into the R.2.2.1 software. Background signals were subtracted using the Robust Multichip Analysis (RMA) whereas the normalization of the signal intensities within slides was carried out using M-bM-^@M-^\print-tip loessM-bM-^@M-^] method and the LIMMA package. Normalized data were log2 transformed and then fitted into mixed model ANOVAs using the Mixed procedure. The p-values of the phtL effects were adjusted for by the False Discovery Rate Method M-bM-^@M-^\FDRM-bM-^@M-^]. Changes in signal intensity of M-BM-11.5-fold or higher/lower between phtL- mutant and wild type were highly significant (FDR, p-value M-bM-^IM-$0.05), however we focused only in differential expressed genes that fell within the more traditional criteria, which is the cut-off threshold for up-regulated (M-bM-^IM-%1.8) and down-regulated genes (M-bM-^IM-$0.50).
2013-12-28 | E-GEOD-44554 | biostudies-arrayexpress
Project description:Background Dickeya dadantii is a necrotrophic pathogen causing disease in many plants. Previous studies have demonstrated that the type III secretion system (T3SS) of D. dadantii is required for full virulence. HrpL is an alternative sigma factor that binds to the hrp box promoter sequence of T3SS genes to up-regulate their expression. Methodology/Principal Findings To explore the inventory of HrpL-regulated genes of D. dadantii 3937 (3937), transcriptome profiles of wild-type 3937 and a hrpL mutant grown in a T3SS-inducing medium were examined. Using a cut-off value of 1.5, significant differential expression was observed in sixty-three genes, which are involved in various cellular functions such as type III secretion, chemotaxis, metabolism, regulation, and stress response. A hidden Markov model (HMM) was used to predict candidate hrp box binding sites in the intergenic regions of 3937, including the promoter regions of HrpL-regulated genes identified in the microarray assay. In contrast to biotrophic phytopathgens such as Pseudomonas syringae, among the HrpL up-regulated genes in 3937 only those within the T3SS were found to contain a hrp box sequence. Moreover, direct binding of purified HrpL protein to the hrp box was demonstrated for hrp box-containing DNA fragments of hrpA and hrpN using the electrophoretic mobility shift assay (EMSA). In this study, a putative T3SS effector DspA/E was also identified as a HrpL-upregulated gene, and shown to be translocated into plant cells in a T3SS-dependent manner. Conclusion/Significances We provide the genome-wide study of HrpL-regulated genes in a necrotrophic phytopathogen (D. dadantii 3937) through a combination of transcriptomics and bioinformatics, which led to identification of several effectors. Our study indicates the extent of differences for T3SS effector protein inventory requirements between necrotrophic and biotrophic pathogens, and may allow the development of different strategies for disease control for these different groups of pathogens. Analysis used aerobic steady state RNA from wild-type as control samples for comparison to the experimental samples of hrpL mutant taken 6 h post-inoculation in T3SS inducible minimum media. The microarray results are based on the geomean of ten normalized expression values derived from three biological replicates and two dye-swap experiments with a technology replicate for each array.
2010-10-21 | E-GEOD-17185 | biostudies-arrayexpress
Project description:The faecal indicator bacterium Escherichia coli K12 was used to study the effects of the global regulators RpoS and cAMP at the transcription level using microarray technology during short-term (physiological) adaptation to slow growth under limited nutrient supply. Effects due to the absence of one global regulator were assessed by comparing the mRNA levels isolated from rpoS or cya mutants under glucose-limited continuous culture at a dilution rate of 0.3 h-1 for the rpoS mutant or 0.16 h-1 for the cya mutant with those from wt E. coli grown under the same conditions. Wild-type Escherichia coli K12 MG1655 (ATCC 700926), E. coli delta-rpoS (MG1655 delta-rpoS::Tn10; Wick et al. (2002)) and AMS2 (MG1655 delta-cya-854; Schultz et al. (1988)) were grown at 37°C in mineral medium. Steady-state with respect to optical density was reached approximately 20 hours after switching on the medium feed. Samples for catabolic pathway assays and transcriptome analysis were taken 40 hours after switching to the continuous culture mode, and each experiment was done in triplicate. 800 ml of culture liquid was withdrawn from the chemostat, immediately cooled down on crushed ice and cells were collected by centrifugation at 4°C. Total RNA from E. coli cells was isolated (Sambrook et al., 1989). RNA in samples was quantified spectrophotometrically by measuring extinction at 260 nm, and purity (free from DNA) was checked by gel electrophoresis. Synthesis of cDNA from RNA was performed with the CyScribe First-Strand cDNA Labelling Kit (Amersham Bioscience, Little Chalfont, England). The purified cDNA was concentrated to 5 ul and was mixed with 120 ul of hybridization buffer (MWG-Biotech AG), heated to 95°C for 3 min and cooled down on ice for 3 min. The hybridization mixture was then added to the microarray slide and covered with a coverslip. The hybridization slide was incubated overnight at 42°C. After the hybridization step, the slide was washed three times, the first time for 5 min in 2x (times concentrated) SSC - 0.1 % SDS, the second time for 5 min in 1x SSC, and finally for 5 min in 0.1x SSC. SSC buffer was prepared as 20x solution containing 0.3M Na-citrate and 3M NaCl at pH 7.0. The slides were dried by centrifugation at room temperature for 2 min at 500g. Microarray slides were scanned using the Affymetrix 428TM Array Scanner (High Wycombe, UK). Spot intensities and corresponding background signals were quantified with the Affymetrix JaguarTM software version 2.0. Further data analysis was performed with the program GeneSpring from Silicon Genetics (Redwood City, USA). Induction factors were calculated from the Cy3 and Cy5 signal intensities of the spot. Spots with signal intensity below a value of 50 were excluded from the analysis and the minimal induction factor was set to 0.01. The normalization was performed with the 50th percentile distribution of remaining spots after background correction. The mean value of the induction factors of a specific gene was calculated from three replicates. Biological experiments were carried out three times, which provided three biological repeats. Data from the independent experiment were combined, genes that were differently regulated ?3 and ?-3 (t-test, p ? 0.2) were defined as being statistically significant.
2010-12-16 | E-GEOD-25982 | biostudies-arrayexpress
Project description:Transcription profiling of Prss16 Tssp can be used to evidentiate further endopeptidase genes candidate to self-peptide generation in the thymus. All mice studied were C57BL/6 background and KO (knockout) Prss16-deficient mice were previously obtained by homologous recombination in embryonic stem (ES) cells of a targeting vector carrying Neo resistance gene marker, which has allowed replacement of exons 8 to 12 of the Prss16 gene in KO mice (data not shown). Briefly, one properly targeted ES clone was injected into BALB/c blastocysts to generate chimeric mice. Chimeric males were mated to C57BL/6 females to generate heterozygous pups in which the Neo selection cassette had been excised. Mice heterozygous for the mutation,originally on mixed 129/Sv x C57BL/6 genetic background, were intercrossed to generate homozygous mutants (Prss16-/-), WT (Prss16+/+) and heterozygousmutants (Prss16+/-) littermates. Genotype analysis was performed on genomic DNA from tail biopsies using PCR primers F (5M-^R GCCTGACACAAGTCGCCATAGG 3M-^R),R1 (5M-^R CCAGTTCCTCCCTCAGCACAG 3M-^R) and R2 (5M-^R CCAGTAAGAGTGAGGTCCAGAC 3M-^R). The WT Prss16 allele was visualized as a 600 bp fragment using the F-R1 pair ofprimers, whereas the mutant allele was visualized as a 447 bp fragment using the F-R2 pair of primers. Absence of mRNA expression in the thymus of Prss16-/- mice was confirmed by northern-blot using a cDNA probe (data not shown). The Prss16 deficient mice were crossed onto a C57BL/6 background for eightgenerations and the thymi of the resulting mice were used for analysis.
2010-08-31 | E-MEXP-2829 | biostudies-arrayexpress
Project description:Xanthomonas oryzae pv. oryzae strain PXO99A, so called Xoo, is disable to infect in rice cultivar carrying Xa21 gene. A set of experiments indicated that Ax21 is quorum sensing factor in PXO99 strain. To observe fine-tuned details how Ax21 controls expression of PXO99 in response to change of cell population density, transcriptional profiling analysis was perform by using published two channel oligo Xo microarray platform (Seo et al.,2008 BMC microbiology). Keywords: Comparative transcription profiling between low cell density and high cell density with same genetic background Three biological and dye-swap replicates, total six samples for each dataset. Two datasets contained; (i) PXO99 at 106 CFU/ml vs 108 CFU/ml, and (ii) PXO99∆ax21at 106 CFU/ml vs PXO99∆ax21 108 CFU/ml. 106 CFU/ml and 108 CFU/ml are cell density used in this study as representation of low and high cell density. All bacteria cultures were grown in PS (Peptone sucrose) broth media.
2012-01-01 | E-GEOD-24989 | biostudies-arrayexpress
Project description:The current project is within the range of molecular immunogenetic auto immune diseases and refers to the comparative study of promiscuous gene expression of tissue-specific antigens (TSAs) in the thymus of NOD mice line (non obese diabetic) who plays the auto-immune diabetes mellitus type 1, during the transition from state pre-diabetics to diabetics. Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, SP, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of S�o Paulo, Campus of Ribeir�o Preto, Brazil. We studied both pre-diabetic (8�2 week-old) and diabetic (20�2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check � Active Kit (Roche Diagn�stica Brasil, S�o Paulo, Brazil). The thymic stroma was separated from the whole thymus, as previously described (Gray et al. 2002). The central idea is to trace signatures of differential gene expression of the thymus at different stages (transition from state pre-diabetics to diabetics) and, using bioinformatics programs, applied to the analysis of data from arrays [Cluster & Tree View (for signatures of expression), SAM (for statistical analysis of the miRNAs and differentially expressed genes from TSAs), GenMiR++ and Cytoscape (to establish networks between miRNAs genes and genes of TSAs)].
2009-10-14 | E-MEXP-2321 | biostudies-arrayexpress
Project description:Oligo microarrays were used to access the transcription profiling of the rheumatoid arthritis patients under two different therapeutic approaches, aiming to evaluate if the cDNA microarray study is able to differentiate responders and non-responders to therapies. In the first experiment (MTX therapy) we analyzed 25 patients from which 8 were classified as MTX responders and 17 MTX non-responders. In the second experiment from the 17 MTX non-responder patients, 8 were non-responders and 9 were responders to additional anti-TNF therapy.
2011-12-31 | E-MEXP-3390 | biostudies-arrayexpress
Project description:DBA/1J mice (12 wk old; weighing 18-22 g) were housed in temperature-controlled rooms (22-25 C) in the animal facility of the School of Medicine of Ribeir o Preto, University of Sao Paulo, Sao Paulo, Brazil, and received water and food ad libitum. Male DBA/1J mice received 200 g of bovine type II collagen (CII) in CFA by intradermal injection (day 0). Collagen (200 ?g in PBS) was given again on day 21 by i.p. injection. Mice were monitored daily for signs of arthritis for which severity scores were derived as follows: 0=normal, 1=erythema, 2=erythema plus swelling, 3= extension/loss function and total score = sum of four limbs. Disease onset characterized by erythema and/or paw swelling was seen between days 25 and 35. For the therapeutic approach, DBA/1 mice were treated with Bosentan (100 mg kg-1) p.o. or vehicle once a day for a total of 11 days. The treatment began on day that CIA became clinically detectable. The DBA-1/J mice were sacrificed preferentially by CO2 inhalation, and the lymph nodes removed. To obtain sufficient mRNA for hybridization to the glass slides, total inguinal lymph nodes RNA was pooled from three mice at each time point (2 inguinal lymph nodes per mouse). Total RNA samples were prepared using Trizol® reagent according to the manufacturers instructions. Undegraded and DNA-, protein- and phenol-free RNA preparations were verified by classic agarose gel electrophoresis stained with ethidium bromide and ultraviolet spectrophotometry, respectively.
2009-10-20 | E-MEXP-2404 | biostudies-arrayexpress