Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Clustered regulatory signals at nucleosome-depleted regions punctuate a constant nucleosomal landscape in Schizosaccharomyces pombe

ABSTRACT: Mononucleosomal DNA analysis of atf1D and pcr1D mutants of Schizosaccharomyces pombe and transcription analysis of exponential wild type 972 h-, atf1D, pcr1D and mitotic diploid pat1.114, and synchronous diploid pat1.114 at 0h, 3h and 5h into meiosis Mononucleosomal DNA vs. genomic input DNA in wildtype 972 h-, atf1D and pcr1D mutants of S. pombe was hybridized to Affymetrix GeneChip 1.0FR tiling microarrays (GPL7715). Total RNA for genome-wide transcription analysis from exponential wild type 972 h-, atf1D, pcr1D and mitotic diploid pat1.114 cells, and from synchronous diploid pat1.114 at 0h, 3h and 5h into meiosis was hybridized to the same microarrays.

ORGANISM(S): Schizosaccharomyces pombe

SUBMITTER: Luis Quintales

PROVIDER: E-GEOD-41770 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Clustered regulatory elements at nucleosome-depleted regions punctuate a constant nucleosomal landscape in Schizosaccharomyces pombe.

Soriano Ignacio I Quintales Luis L Antequera Francisco F

BMC genomics 20131121

<h4>Background</h4>Nucleosomes facilitate the packaging of the eukaryotic genome and modulate the access of regulators to DNA. A detailed description of the nucleosomal organization under different transcriptional programmes is essential to understand their contribution to genomic regulation.<h4>Results</h4>To visualize the dynamics of individual nucleosomes under different transcriptional programmes we have generated high-resolution nucleosomal maps in Schizosaccharomyces pombe. We show that 98 ...[more]

PMID: 24256300

Similar Datasets

Clustered regulatory signals at nucleosome-depleted regions punctuate a constant nucleosomal landscape in Schizosaccharomyces pombe

Project description:Sequencing of mononucleosomal DNA during asynchronous mitosis and 0, 3 and 5 hours into meiosis in Schizosaccharomyces pombe. Two samples from mononucleosomal DNA from asynchronous mitosis (haploid 972 h- and diploid pat1.114) and three samples from 0, 3 and 5 hours into meiosis (from diploid pat1.114) were sequenced (Illumina Genome Analyzer IIx) using the single-end read protocol.

2013-11-25 | E-GEOD-41772 | biostudies-arrayexpress

Clustered regulatory signals at nucleosome-depleted regions punctuate a constant nucleosomal landscape in Schizosaccharomyces pombe

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2013-11-25 | E-GEOD-41773 | biostudies-arrayexpress

Clustered regulatory signals at nucleosome-depleted regions punctuate a constant nucleosomal landscape in Schizosaccharomyces pombe [Affymetrix]

Project description:Mononucleosomal DNA analysis of atf1D and pcr1D mutants of Schizosaccharomyces pombe and transcription analysis of exponential wild type 972 h-, atf1D, pcr1D and mitotic diploid pat1.114, and synchronous diploid pat1.114 at 0h, 3h and 5h into meiosis

2013-11-25 | GSE41770 | GEO

Transcriptional response of Schizosaccharomyces pombe to 5-Fluorouracil (5FU)

Project description:We use high-density tiling DNA microarray technology to obtain the specific transcriptome-wide response induced by 5-Fluorouracil (5FU) in the eukaryotic model Schizosaccharomyces pombe. Schizosaccharomyces pombe cultures with 5FU added to a final concentration of 500 M-NM-<M. Incubation was allowed to proceed for 0, 15, 60 and 240 minutes.Two biological replicates each.

2013-11-14 | E-GEOD-46919 | biostudies-arrayexpress

Ustilago maydis rak1 mediated gene expression during exponential growth

Project description:In mammalian cells RACK1 serves as a scaffold protein that has a role in integrating inputs from different signaling pathways and affects translation through association with ribosomes. U. maydis contains a seven-WD40 repeat motif protein designated Rak1, which shows 68% identity to RACK1 and is homologous to Asc1p of Saccharomyces cerevisiae. The asc1 mutant could be complemented by introduction of U. maydis rak1. The deletion of rak1 affected cell growth, cell wall integrity and specifically attenuated cell fusion. This latter defect was caused by reduced expression of prf1 encoding the regulator for pheromone and pheromone-receptor genes. Rak1 interacts with a variety of ribosomal proteins and microarray analysis revealed that the deletion of rak1 led to severely reduced expression of rop1, an activator prf1. The constitutive expression of rop1 could rescue the defect of mfa1 expression as well as conjugation tube formation in response to pheromone induction in the rak1 mutant. Moreover, a solopathogenic rak1 mutant failed to respond to plant derived stimuli, resulting in attenuated filamentation and pathogenicity. This could be partially rescued by constitutive expression of the b heterodimer. These data suggest that rak1 is a regulator of rop1 expression with additional roles after cell fusion. Ustilago maydis strains FB1 and FB1?rak1 were grown on a rotary shaker (200 rpm) in liquid Ustilago complete medium with 1% glucose at 28°C to an OD600 of 0.5. The experiment was performed using three independent biological replicates per strain.

2011-07-05 | E-GEOD-30382 | biostudies-arrayexpress

A functional screen for copper homeostasis genes identifies a pharmacologically tractable cellular system

Project description:Copper is an essential component of cytochrome C oxidase (i.e. complex IV of the electron transport chain), and is thus critical for the survival of aerobic organisms. If copper is not properly regulated in the body however, it can be extremely cytotoxic and genetic mutations that compromise copper homeostasis result in severe clinical phenotypes. Understanding how cells maintain optimal copper levels is therefore highly relevant to human health. We found that addition of copper to culture medium leads to increased respiratory growth of yeast, a phenotype which we then systematically and quantitatively measured in 5050 homozygous diploid deletion strains using microarrays. In the yeast homozygous gene deletion collection, both copies of every non-essential gene are deleted in a diploid strain. Each strain contains unique 20-bp M-bM-^@M-^\barcodeM-bM-^@M-^] sequences flanked by common priming sites, allowing the relative abundance of individual strains to be quantitatively monitored within a pool of competitively-grown strains. To identify genes that are important for Cu-dependent respiratory growth, we measured the fitness of 5050 homozygous deletion strains in parallel in rich media (i.e. Yeast Extract, Peptone) using either dextrose, ethanol, glycerol, or lactate as a carbon source, in the presence or absence of 500 M-BM-5M CuSO4 for 9 generations. Each condition was tested in triplicate. Please note that there is a large percentage of null-values (i.e. Not Available) in the respiration deficient-pool samples because the respiration deficient pool consists of only a small subset of the complete pool (represented by 331 barcodes instead of 9937). For our analysis we discarded the remaining barcodes by assigning the null-value to them.

2013-05-23 | E-GEOD-47175 | biostudies-arrayexpress

nucleosome profiles 972 EMM

Project description:nucleosome profiles 972 EMM

| PRJEB21376 | ENA

Interactions of CAF1-NOT complex components from Trypanosoma brucei

Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)

2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress

Oncogenic Herpesvirus utilizes stress-induced cell cycle checkpoints for efficient lytic replication.

Project description:ChIP-sequencing reads from Oncogenic Herpesvirus utilizes stress-induced cell cycle checkpoints for efficient lytic replication, accepted to PLOS Pathogens

2016-06-01 | E-MTAB-4356 | biostudies-arrayexpress

Transcription profiling by array of Nab2 depletion effect on yeast mRNA

Project description:Transcription profiling was performed on the time course of Nab2 protein depletion in THC-Nab2 strain at 0h, 7h, 12h in biological triplicates to access its affect on the composition and structure of mRNA in budding yeast. For the protein depletion experiment THC-NAB2 (THJ collection Y2484, THC-NAB2:KAN tTA:URA, Open Biosystems) strain was used, where expression of the NAB2 gene is under control of a tetracyclin-repressible promoter.

2013-01-11 | E-MTAB-981 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data