Bombyx mori Argonaute2 associated small RNAs
Ontology highlight
ABSTRACT:
ORGANISM(S): Bombyx mori
SUBMITTER: Nie Zuoming
PROVIDER: E-GEOD-41841 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:In this study we investigated the small RNAs expression profiling of three HCC cell lines with different organ-tropism.The parent cell line has low mestastasis ability in nude mice model. Subclone 1 has higher metastasis ability specific to lung, and subclone 2 has dual metastasis ability to lung and celiac lymph node. We aimed to explore differentially expressed small RNAs involved in process of HCC metastasis and organ-specific metastasis, and identify their biological functions. Examination of different small RNAs expression among the 3 cell types.
2014-06-30 | E-GEOD-39003 | biostudies-arrayexpress
Project description:Argonaute (AGO) proteins interact with distinct classes of small RNAs to direct multiple regulatory outcomes. In many organisms, including plants, fungi and nematodes, cellular RNAdependent RNA polymerases (RdRPs) utilize AGO targets as templates for amplification of silencing signals. Here, we show that distinct RdRPs function sequentially to produce small RNAs that target endogenous loci in C. elegans. We show that DCR-1, the RdRP RRF-3, and the dsRNA-binding protein RDE-4, are required for the biogenesis of 26nt RNAs, termed 26GRNAs, and that 26G-RNAs engage the Piwi-clade AGO, ERGO-1. Our findings support a model in which targeting by ERGO-1 recruits a second RdRP (RRF-1 or EGO-1), which in turn transcribes 22G-RNAs that interact with worm-specific AGOs (WAGOs) to direct gene silencing. ERGO-1 targets exhibit a non-random distribution in the genome and appear to include many gene duplications, suggesting that this pathway may control over-expression resulting from gene expansion. 8 samples examined. Small RNA libraries generated from: C. elegans animals.
2010-02-25 | E-GEOD-18714 | biostudies-arrayexpress
Project description:High-throughput pyrosequencing of endogenous small RNAs from >95% male enriched populations of alg-3(tm1155);alg-4(ok1041);fog-2(q71) and fog-2(q71) worms as well as purified spermatids from fem-3(q20) adult worms. Gametogenesis is thermosensitive in numerous metazoa ranging from worms to man. In C. elegans a variety of germ-line nuage- (P-granule) -associated RNA-binding proteins including the Piwi-clade Argonaute, PRG-1, have been implicated in temperature-dependent fertility. Here, we describe the role of two AGO-class paralogs, alg-3 (T22B3.2) and alg-4 (ZK757.3) in promoting male fertility at elevated temperatures. A rescuing GFP::alg-3 transgene is localized in P-granules beginning at the late pachytene stage of male gametogenesis. alg-3/4 double mutants lack a subgroup of small RNAs, named 26G-RNAs, which target and appear to down-regulate numerous spermatogenesis-expressed mRNAs. These findings add to a growing number of AGO pathways required for temperature-dependent fertility in C. elegans and support a model in which AGOs and their small RNA co-factors function to promote robustness in gene-expression networks. 3 samples examined. Small RNAs from alg-3(tm1155);alg-4(ok1041);fog-2(q71) males and fog-2(q71) males. Small RNAs from spermatids isolated from ferm-3(q20) worms.
2010-02-24 | E-GEOD-18729 | biostudies-arrayexpress
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:MicroRNAs (miRNAs) are a class of small RNAs which typically function by guiding cleavage of target messenger RNAs. They have been shown to play major roles in a variety of plant processes including development, and responses to pathogens and environmental stresses. To identify new miRNAs and regulation in Arabidopsis thaliana, 27 small RNA libraries were constructed and sequenced from various tissues, stresses and small RNA biogenesis mutants, resulting in 95 million genome-matched sequences. The use of rdr2 to enrich the miRNA population greatly enhanced this analysis and led to the discovery of 44 new miRNAs arising from both known and new precursors. Parallel Analysis of RNA Ends (PARE) data provide evidence that the majority guide target cleavage. The inclusion of novel stress/tissue conditions, such as submergence-stressed flowers, enabled identification of new stress regulation of both miRNAs and their targets, all of which were validated in wild type plants. By combining small RNA expression analysis with ARGONAUTE (AGO) immunoprecipitation data and global target cleavage data from PARE, a much more complete picture of Arabidopsis miRNAs was obtained. This combinatorial approach led to the discovery of AGO loading and target cleavage biases, which gave important insights into tissue-specific expression patterns, pathogen responses and the role of sequence variation among closely related miRNA family members. Examination of various tissues, stresses and small RNA biogenesis mutants in Arabidopsis by high-throughput sequencing for small RNA profiling. We have used AGO-IP and PARE data from the published data, which were downloaded from NCBI GEO with the following accession number. AGO-IP from GSM253622, GSM707682, GSM642335, GSM642336, GSM512703, GSM512702, GSM707683, GSM707684, GSM707685, GSM149080, GSM253623, GSM304283, GSM642337, GSM642338, GSM253624, GSM415788, GSM707686, GSM707687, GSM707688, GSM707689, GSM415787, GSM149081, GSM253625, GSM415789, GSM415790, GSM304285, GSM415791, GSM415792 PARE sequencing data from xrn4 flowers were obtained from Gene Expression Omnibus with accession number GSM280227.
2013-12-31 | E-GEOD-44622 | biostudies-arrayexpress
Project description:Background & Aims: MicroRNAs have been shown to offer great potential in the diagnosis of cancer. We aimed to identify microRNAs in peripheral blood mononuclear cells (PBMCs) for diagnosing pancreatic cancer (PC). Methods: PBMCs microRNA expression was investigated in three independent cohorts including 352 participants (healthy, benign pancreatic/peripancreatic diseases (BPD), and PC). First, we used sequencing technology to identify differentially expressed microRNAs in 60 PBMCs samples for diagnosing PC. Quantitative reverse-transcriptase polymerase chain reaction assay was then applied to evaluate the expression of selected microRNAs. A logistic regression model was constructed using an independent cohort. Area under the receiver operating characteristic curve (AUC) was used to evaluate diagnostic accuracy. Results: We found that PBMCs miR-27a-3p could efficiently discriminate PC from BPD (AUC=0.840; 95% CI, 0.787 to 0.885; sensitivity=82.2%, specificity=76.7%). A panel composed of PBMCs miR-27a-3p and serum CA19-9 provided a high diagnostic accuracy in differentiating PC from BPD in the clinical setting (AUC=0.886; 95% CI, 0.837 to 0.923; sensitivity=85.3%, specificity=81.6%). The satisfactory diagnostic performance of the panel persisted regardless of disease status (AUCs for tumour-node-metastasis stages?,?, and ? were 0.881, 0.884, and 0.893, respectively). Conclusion: PBMCs miR-27a-3p could be a potential marker for PC screening. A panel composed of PBMCs miR-27a-3p and serum CA19-9 has considerable clinical value in diagnosing early-stage PC. Therefore, patients who would have otherwise missed the curative treatment window can benefit from optimal therapy. Examination of different MicroRNA profiles in 3 types of PBMCs samples
2012-05-03 | E-GEOD-37710 | biostudies-arrayexpress
Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses. AGO1-DDH (wild type) AGO1-DAH (slicer mutant) proteins were immunoprecipitated (N-terminal 3xHA) from Arabidopsis (Columbia) flower (stages 1-12) lysate. Immunoprecipitations were also done from control plants transformed with vector only. Small RNA from immunoprecipitate fractions of vector, AGO1-DDH and AGO1-DAH were sequenced.
2012-09-28 | E-GEOD-40258 | biostudies-arrayexpress
Project description:This study provides a first large-scale cloning and characterization of Sclerotinia sclerotiorum milRNAs and milRNAs candidates. Two microRNA-like RNAs (milRNAs) and 42 milRNA candidates were identified by sequence analysis. These milRNAs and candidates provide new insights into the functional roles of small RNAs and adds new resources for the study of plant pathogenic fungi. We constructed a small RNA library from Sclerotinia sclerotiorum.
2012-05-17 | E-GEOD-28730 | biostudies-arrayexpress
Project description:Background: MiRNAs and phasiRNAs are negative regulators of gene expression. These small RNAs have been extensively studied in plant model species but only 10 mature microRNAs are present in miRBase version 21 and no phasiRNAs have been identified for the legume model Phaseolus vulgaris. Thanks to the recent availability of the first version of the common bean genome, degradome data and small RNA libraries, we are able to present here a catalog of the microRNAs and phasiRNAs of this organism and, particularly, new protagonists of the symbiotic nodulation events. Results: We identified a set of 185 mature miRNAs, including 121 previously unpublished sequences, encoded by 307 precursors and distributed in 98 families. Degradome data allowed us to identify a total of 181 targets for these miRNAs. We reveal two regulatory networks involving conserved miRNAs, known to play crucial roles in the well-establishment of nodules, and novel miRNAs specific of the common bean suggesting a specific action of these sequences. In parallel, we identified 125 loci that potentially produce phased small RNAs and 47 of them present all the characteristics to be triggered by a total of 31 miRNAs, including 14 new miRNAs identified in this study. Conclusions: We provide here a set of new small RNAs, which contribute to the broader scene of the sRNAome of Phaseolus vulgaris. Thanks to the identification of the miRNA targets from degradome analysis and the construction of regulatory networks between the mature microRNAs, we draw up here the probable functional regulation associated with the sRNAome and particularly in N2-fixing symbiotic nodules. Small RNA sequencing from 5 Phaseolus vulgaris tissues
2015-09-01 | E-GEOD-67409 | biostudies-arrayexpress
Project description:Small non-coding RNAs play important roles in regulating gene expression during development and disease. However, a comprehensive analysis of small RNAs in developing brain is largely lacking. By using next-generation sequencing technique, we carried out a systematic analysis of small RNA transcriptome of rat neocortex from early developmental stage till adult. Our results revealed an extraordinary degree of stage-specific profiling of miRNA, and other classes of small RNAs including snoRNA, rasRNA, scRNA and unexpectedly piRNA, which was considered to be solely expressed in germline tissues. Developmentally regulated miRNA editing was also observed. This study further showed the effectiveness of the high through-put sequencing in genome-wide analysis of small RNAs. The dataset described here will greatly contribute to our understanding of the divergence, variation, and function of small RNAs and may be a valuable resource in clarifying new regulatory mechanisms of cortical development. Identification and quantification of small RNA: forebrain and cortex from E10 to P28
2012-06-25 | E-GEOD-27576 | biostudies-arrayexpress