Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

46 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Frac-seq reveals preferential polyribosome association of minor mRNA isoforms

ABSTRACT: The goal of this study was to test the hypothesis that minor alternative mRNA isoforms can be preferentially translated. Included are Cytoplasm and Polyribosome samples in duplicate from both Control and Rapamycin treated cells.

ORGANISM(S): Homo sapiens

SUBMITTER: Jeremy Sanford

PROVIDER: E-GEOD-45237 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

The RNA binding protein IGF2BP3 promotes hematopoietic progenitor cell proliferation by targeting leukemogenic pathways

Project description:The goal of this study was to determine IGF2BP3 RNA targets in human B-cell Acute Lymphocitic Leukemia cell models. Included are iCLIP-seq libraries for IGF2BP3 from RS4;11 and REH B-ALL cell samples and RNA-seq data sets from control and IGF2BP3 knockdown RS4;11 B-ALL cell lines

2016-01-16 | E-GEOD-76931 | biostudies-arrayexpress

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Profiling of soma and neurite transcriptomes

Project description:We report mRNA profiles of subcellularly localized transcriptomes (soma and neurite) of two mouse cell lines, N2A and CAD, as well as primary cortical neurons from E18.5 mice. We also performed this fractionation and sequencing after RNAi knockdown (cell lines) or in knockout mice (primary cortical neurons) of the RNA-binding proteins muscleblind 1 and 2 (Mbnl1 and Mbnl2). Fractionate neurons using porous transwell membranes. Isolate poly-A RNA.

2016-02-19 | E-GEOD-67828 | biostudies-arrayexpress

IGF2BP3 controls cancer cell invasiveness by modulation RISC function

Project description:The goal of this study was to determine IGF2BP3 regulation of RNA targets in human pacreatic ductal adenocarcinoma cell lines Included are iCLIP-seq libraries for IGF2BP3 from PL45 and Panc1 PDAC cell samples, RIP-seq samples from PL45 and Panc1 PDAC cells, RNA-seq data sets from control and IGF2BP3 knockdown in PL45 and Panc1 PDAC cells, and small RNA-seq samples from Panc1 cells

2016-03-12 | E-GEOD-79147 | biostudies-arrayexpress

HP1 is involved in regulating the global impact of DNA methylation on alternative splicing

Project description:The global impact of DNA methylation on alternative splicing is largely unknown. Using a genome-wide approach in wild-type and methylation-deficient embryonic stem cells, we found that DNA methylation can act both as an enhancer and as a silencer of splicing, and affects the splicing of more than 20% of alternative exons. These exons are characterized by distinct genetic and epigenetic signatures. Alternative splicing regulation of a subset of these exons can be explained by Heterochromatin protein 1 (HP1), which silences or enhances exon recognition in a position-dependent manner. We constructed an experimental system using site-specific targeting of a methylated/unmethylated gene, and demonstrate a direct causal relationship between DNA methylation and alternative splicing. HP1 regulates this geneM-bM-^@M-^Ys alternative splicing in a methylation-dependent manner by recruiting splicing factors to its methylated form. Our results demonstrate DNA methylation's significant global influence on mRNA splicing, and identify a specific mechanism of splicing regulation mediated by HP1. BS-seq on WT mouse ES cells (2 replicates), MNase-seq on WT and TKO cells (3 replicates), mRNA-seq on WT and TKO cells as well as HP1 knock-down cells (2 replicates for each sample)

2015-03-08 | E-GEOD-64910 | biostudies-arrayexpress

Knockdown of SR protein family in P19 cells and RNA-seq of cytoplasmic and whole cell polyA+ RNA

Project description:Our data suggest that all SR proteins contribute to mRNA export via NXF1. To identify endogenous export targets we depleted all seven SR proteins individually from P19 WT cells prepared cytoplasmic fractions. We sequenced the cytoplasmic fraction and as a control whole celll RNA from the identical sample. Knockdown of seven SR Proteins plus control, total RNA and cytoplasmic RNA, polyA+ enriched, 2 biological replicates per condition, 2 technical replicates per condition

2016-03-07 | E-GEOD-69733 | biostudies-arrayexpress

Identification of alternatively spliced transcripts in brain metastatic derivatives of MDA-MB-231 breast cancer cells in response to RBM47 expression

Project description:Changes in alternative splicing in breast cancer cells expressing control, empty vector or Flag-tagged wild type RBM47 were analyzed using paired-end, 100bp RNAseq. Related data published together with these data are found in GSE53779 Triplicate RNAseq libraries were prepared from non-clonal brain metastatic breast cancer cells stably expressing empty-vector, and a clonal cell line (wt#10) expressing Flag-tagged, wild-type RBM47 under a doxycline-inducible promoter, both treated for three days with doxycycline to induce transgene expression

2014-06-11 | E-GEOD-58379 | biostudies-arrayexpress

Developmental arrest of Drosophila survival motor neuron (Smn) mutants accounts for differences in expression of minor intron-containing genes

Project description:RNA-seq was used to analyze mRNA levels and splicing differences between wild-type (Oregon R) and Smn null mutant larvae. Illumina RNA-seq of Oregon R and Smn mutant age-matched larvae from RNA extracted on day four post egg laying. Conclusions from this study used the publicly available modENCODE data from Graveley et al. Nature 2011 (in addition to our RNA-seq data). We downloaded their SRA files, dumped them to fastq files, and put them through our same analysis pipelines. The renalysis data and details are provided in 'reanalysis.tar' and readme_reanalysis.txt. The Cufflinks processed file outputs (22 files in 'Cufflinks_outputs.tar') are derived from all of our raw sample files and all of the developmental data mentioned in the readme.txt file. The file format and content description is provided in the 'readme_for_Cufflinks.txt' Unlike Cufflinks cuffdiff analysis that merged our data with the developmental data, the MISO and DEXSeq analysis was carried out in parallel with analysis of our samples. This generated two additional files for the DEXSeq developmental analysis (DEXSeq output; paired end developmental Graveley et al. Nature 2011): L2_L3P1_2_DEUtable.txt L312hr_L3P1_2_DEUtable.txt Please note that MISO lacks the capacity to incorporate replicates, which contributed to the abundance of these file types. MISO output file names are prepended with the respective sample/raw data names. For example, EG003_EG007.*miso_bf.txt.gz are MISO comparison of Ore-R R1 (EG003) and Smn R1 (EG007).

2013-08-07 | E-GEOD-49587 | biostudies-arrayexpress

Genome wide mapping of effects of U6atac knockdown on pre-mRNA splicing

Project description:This project looks into experimentally identifying all minor introns by knocking down the minor spliceosome's catalytic snRNP, U6atac. Knockdown of U6atac by antisense morpholino followed by examining mRNA splicing by RNA-seq

2013-08-01 | E-GEOD-48263 | biostudies-arrayexpress

Drosophila PTB regulates dorso-ventral patterning genes in embryos

Project description:Drosophila PTB (Polypyrimidine Tract-binding protein dmPTB) regulates dorso-ventral patterning genes in embryos Comparison of wild type (yw genotype) and PTB mutant (heph03429) drosophila embryos

2014-05-10 | E-GEOD-57517 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data