Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

34 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

ABSTRACT: We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies.M-BM- In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk.M-BM- In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. M-BM- Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model.M-BM- Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. R940406 (R406, the active metabolite of fostamatinib) was supplied by Rigel Pharmaceuticals, Inc., South San Francisco, CA, and AstraZeneca Pharmaceuticals, Wilmington, DE, USA. R406 was resuspended in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) and stored at M-bM-^HM-^R80M-BM-0C. . HL-60, U937 and KG-1 cell lines were purchased from the American Type Culture Collection. MOLM-14 cell lines were provided by Dr. Scott Amstrong (Dana-Farber Cancer Institute, Boston MA, USA.) All cell lines were maintained in RPMI 1640 (Cellgro) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS, Sigma-Aldrich) at 37 M-BM-0C with 5% CO2. MOLM-14, U937, HL-60 and KG-1 cells were grown in 4mM R406 for 24 hours

ORGANISM(S): Homo sapiens

SUBMITTER: Gabriela Alexe

PROVIDER: E-GEOD-46302 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

Project description:We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. R940406 (R406, the active metabolite of fostamatinib) was supplied by Rigel Pharmaceuticals, Inc., South San Francisco, CA, and AstraZeneca Pharmaceuticals, Wilmington, DE, USA. R406 was resuspended in dimethyl sulfoxide (DMSO) (Sigma-Aldrich) and stored at −80°C. . HL-60, U937 and KG-1 cell lines were purchased from the American Type Culture Collection. MOLM-14 cell lines were provided by Dr. Scott Amstrong (Dana-Farber Cancer Institute, Boston MA, USA.) All cell lines were maintained in RPMI 1640 (Cellgro) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS, Sigma-Aldrich) at 37 °C with 5% CO2.

2013-04-24 | GSE46302 | GEO

GSK-3A and GSK-3B knockdown in AML cell lines

Project description:Gene expression data from AML cell lines, MOLM-14, U937, THP-1 and HL-60, that were infected with a scrambled control hairpin (shControl), two shRNAs directed against GSK-3B (shGSK3B_1 and shGSK3B_2), or two shRNAs directed against GSK-3A (shGSK3A_5 and shGSK3A_6). Acute myeloid leukemia (AML) is the most common form of acute leukemia in adults. Long-term survival of patients with AML has changed little over the past decade, necessitating the identification and validation of new AML targets. Integration of genomic approaches with small-molecule and genetic-based high-throughput screening holds the promise of improved discovery of candidate targets for cancer therapy. Here, we identified a role for glycogen synthase kinase 3A (GSK-3A) in AML by performing two independent small-molecule library screens and an shRNA screen for perturbations that induced a differentiation expression signature in AML cells. GSK-3 is a serine-threonine kinase involved in diverse cellular processes including differentiation, signal transduction, cell cycle regulation, and proliferation. We demonstrated that specific loss of GSK-3A induced differentiation in AML by multiple measurements, including induction of gene expression signatures, morphological changes, and cell surface markers consistent with myeloid maturation. GSK-3AM-bM-^@M-^Sspecific suppression also led to impaired growth and proliferation in vitro, induction of apoptosis, loss of colony formation in methylcellulose, and anti-AML activity in vivo. Although the role of GSK-3B has been well studied in cancer development, these studies support a role for GSK-3A in AML. The AML cell lines, MOLM-14, U937, THP-1 and HL-60, were infected with a scrambled control hairpin (shControl), two shRNAs directed against GSK-3B (shGSK3B_1 and shGSK3B_2), and two shRNAs directed against GSK-3A (shGSK3A_5 and shGSK3A_6).

2012-02-27 | E-GEOD-35200 | biostudies-arrayexpress

Gene expression profiling of two diffuse large B-cell lymphoma (DLBCL) cell lines, DHL4 and DHL6, treated with the SYK inhibitor, R406

Project description:The two DLBCL cell lines were treated with R406 to assess the signature of SYK inhibition. In previous studies, R406 decreased the proliferation and induced apoptosis of these surface Ig+ cell lines. In the previous studies, R406 inhibited the autophosphorylation of SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK. RNA samples from two DLBCL cell lines, DHL4 and DHL6, treated with R406 or vehicle (DMSO) alone for 0, 2, 6, 24 or 48 hours were profiled in triplicate on Affymetrix HT_HG-U133A chips.

2013-12-31 | E-GEOD-34176 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Gene expression profiling of five diffuse large B-cell lymphoma (DLBCL) cell lines, DHL4, DHL6, LY7, HBL1 and U2932, treated with the SYK inhibitor, R406

Project description:The five DLBCL cell lines were treated with R406 to assess the signature of SYK inhibition. In previous studies, R406 decreased the proliferation and induced apoptosis of these surface Ig+ cell lines. In the previous studies, R406 inhibited the autophosphorylation of SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK. RNA samples from five DLBCL cell lines treated with R406 or vehicle (DMSO) alone for 0, 6, or 24 hours were profiled in triplicate on Affymetrix HT_HG-U133plust2 chips.

2013-08-31 | E-GEOD-43510 | biostudies-arrayexpress

Effects of matrine on gene expression of myeloid leukemia cells

Project description:To investigate the molecular mechanism of matrine's anti-myeloid leukemia effect, Acute myeloid leukemia cells HL-60 and U937 and chronic myeloid leukemia cells K562 were treated with 0.8mg/mL matrine for 30min and 24h, respectively. Then, RNA-Seq data before and after matrine treatment were used for gene expression profile analysis

2022-11-09 | GSE201309 | GEO

Expression Profiles of HepG2 cells treated with following compounds: Azathriopine, Furan, Tetradecanoyl phorbol acetate, Tetrachloroethylene, Diazinon and Dmannitol

Project description:The transcriptomic changes induced in the human liver cell line HepG2 by Azathriopine (250M-BM-5M, Sigma-Aldrich), Furan (2mM, Sigma-Aldrich), Tetradecanoyl phorbol acetate (500nM, Sigma-Aldrich), Tetrachloroethylene (2mM, Sigma-Aldrich), Diazinon (250M-BM-5M, Sigma-Aldrich) and Dmannitol (250M-BM-5M, Sigma-Aldrich) during 4, 8, 24, 48 and 72hrs As a solvent control for Azathriopine, Furan, Diazinon and Tetradecanoyl phorbol acetate, DMSO was used (0.5%); As a solvent control for tetrachloroethylene, ethanol was used (0.5%); As a solvent control for D-mannitol, HBSS was used (0.5%) The study investigated differential gene expression in HepG2 cell line mRNA following 4, 8, 24, 48 and 72h hours of exposure to Azathriopine, Furan, Tetradecanoyl phorbol acetate, Tetrachloroethylene, Diazinon, D-mannitol, DMSO solvent control, ethanol solvent control and HBSS solvent control. Three biological replicates per compound/solvent. In total 135 arrays were analyzed in total.

2015-01-13 | E-GEOD-58235 | biostudies-arrayexpress

The expression profiles of AML cell lines

Project description:EVI1 is one of the famous poor prognostic markers for a chemotherapy-resistant acute myeloid leukemia (AML). To identify molecular targets on the surface of leukemia cells with EVI1high expression, we compared the gene expression profiles of several AML cell lines by DNA microarray To search for novel molecular targets in refractory myeloid leukemia with high EVI1 expression, we initially analyzed the gene expression profiles of 12 human myeloid cell lines. Four cell lines with chromosome 3q26 abnormalities (UCSD/AML1, HNT-34, Kasumi-3 and MOLM-1) expressed EVI1High, and eight myeloid cell lines without chromosome 3q26 abnormalities (HEL, HL-60, K052, THP-1, FKH-1, K051, NH and OIH-1) expressed low levels of EVI1 (EVI1Low)

2012-01-18 | E-GEOD-35159 | biostudies-arrayexpress

Induction of microRNA expression and processing via ERK/MAPK signaling during monocytic differentiation

Project description:This study produced a microarray-based screening for miRNAs responding to tetradecanoyl phorbol acetate (TPA) (for monocytic differentiation) treatment in various leukemia cell lines. Using the microarray technique, global changes in miRNA expression after treatment of four leukemia cell lines (NB4, HL-60, U937 and K562) with TPA was profiled. This microarray chip contained 924 probes for 802 miRNAs from human, mouse and rat after discarding redundant sequences, and a further 122 predicted miRNA sequences from published data. To reduce individual variability, replicate array analysis used independently treated samples, and a technical replicate was also performed with the same sample.

2013-12-01 | E-GEOD-33537 | biostudies-arrayexpress

GSK-3A and GSK-3B knockdown in AML cell lines

Project description:Gene expression data from AML cell lines, MOLM-14, U937, THP-1 and HL-60, that were infected with a scrambled control hairpin (shControl), two shRNAs directed against GSK-3B (shGSK3B_1 and shGSK3B_2), or two shRNAs directed against GSK-3A (shGSK3A_5 and shGSK3A_6). Acute myeloid leukemia (AML) is the most common form of acute leukemia in adults. Long-term survival of patients with AML has changed little over the past decade, necessitating the identification and validation of new AML targets. Integration of genomic approaches with small-molecule and genetic-based high-throughput screening holds the promise of improved discovery of candidate targets for cancer therapy. Here, we identified a role for glycogen synthase kinase 3A (GSK-3A) in AML by performing two independent small-molecule library screens and an shRNA screen for perturbations that induced a differentiation expression signature in AML cells. GSK-3 is a serine-threonine kinase involved in diverse cellular processes including differentiation, signal transduction, cell cycle regulation, and proliferation. We demonstrated that specific loss of GSK-3A induced differentiation in AML by multiple measurements, including induction of gene expression signatures, morphological changes, and cell surface markers consistent with myeloid maturation. GSK-3A–specific suppression also led to impaired growth and proliferation in vitro, induction of apoptosis, loss of colony formation in methylcellulose, and anti-AML activity in vivo. Although the role of GSK-3B has been well studied in cancer development, these studies support a role for GSK-3A in AML.

2012-02-27 | GSE35200 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data