Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

41 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

ABSTRACT: Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

ORGANISM(S): Homo sapiens

SUBMITTER: Gabriela Alexe

PROVIDER: E-GEOD-54065 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.

2014-01-15 | GSE54065 | GEO

Human acute myeloid leukemia (AML) cell line LFQ, comparison between doxycycline-inducible control shRNA and Pim2 shRNA

Project description:Acute myeloid leukemia (AML) with the FLT3 internal tandem duplication (FLT3-ITD AML) accounts for 20-30% of AML cases. This subtype usually responds poorly to conventional therapies including FLT3 tyrosine kinase inhibitors (TKIs) due to molecular bypass mechanisms. New therapeutic strategies are therefore urgently needed. Pim kinases are FLT3-ITD oncogenic targets that have been implicated in FLT3 TKI resistance. However, their precise biological function downstream of FLT3-ITD requires further investigation. MOLM-14 is a human FLT3-ITD AML cell line that was transduced with control (scrambled) or anti-Pim2 shRNA using lentivirus. Expression of hairpins was induced by doxycycline during 3 days and the experiments were done in biological triplicates. One million of MOLM-14 shSCR or shPim2 cells were lysed in 200µl lysis buffer (50 mM Tris (pH 8.5), 2% SDS, 20 mM TCEP, 50 mM chloroacetamide) and heated 5 min at 95°C. Proteins (50µg) from whole cell lysate were trypsin-digested overnight using the filtered-aided sample preparation (FASP) method. Liquid chromatography and mass spectrometry analyses were performed on anU3000 RSLC nanoflow-HPLC system coupled to a Q-Exactive Orbitrap mass spectrometer (both from Thermo Fisher Scientific). The analyses of raw data were performed by LFQ on Maxquant software with a maximum of 1% FDR and match between runs enabled within a 0.7 min match time window and 20 min alignment time window. Maxquant LFQ data were analyzed with Perseus, Ingenuity and Excel softwares.

2017-09-18 | PXD005880 | Pride

Phosphoproteome Analysis Reveals Differential Mode of Action of Sorafenib in Wildtype and Mutated FLT3 AML Cells

Project description:Constitutively activating internal tandem duplication (ITD) alterations of the receptor tyrosine kinase FLT3 (Fms-like tyrosine kinase 3) are common in acute myeloid leukemia (AML) and classifies FLT3 as an attractive therapeutic target. So far, application of FLT3 small molecule inhibitors such as Sorafenib has resulted only in partial and transient clinical responses in FLT3-ITD+ patients. Only recently, a prolonged event-free survival has been observed in AML patients who were treated with Sorafenib in addition to standard therapy. Here, we studied the Sorafenib effect on proliferation in a panel of 13 FLT3-ITD- and FLT3-ITD+ AML cell lines. Sorafenib IC50 values ranged from 0.001 to 5.6 µM, whereas FLT3-ITD+ cells (MOLM-13, MV4;11) were found more sensitive to Sorafenib than FLT3-ITD- cells. However, we identified two FLT3-ITD- cell lines (MONO-MAC-1 and OCI-AML-2) which were also Sorafenib sensitive. Phosphoproteome analyses revealed that the affected pathways differed in Sorafenib sensitive FLT3-ITD- and FLT3-ITD+ cells. In MV4;11 cells Sorafenib suppressed mTOR signalling by inhibiting direct inhibition of FLT3. In MONO-MAC-1 cells Sorafenib inhibited the MEK/ERK pathway by inhibition of the RET tyrosine kinase. These data suggest that the FLT3 status in AML patients might not be the only predictive factor for a response to Sorafenib.

2017-05-02 | PXD004442 | Pride

PRMT1-mediated FLT3 arginine methylation is required for maintenance of FLT3-ITD+ Acute Myeloid Leukemia

Project description:The presence of FLT3-ITD mutations in patients with acute myeloid leukemia (AML) is associated with poor clinical outcome. FLT3 tyrosine kinase inhibitors (TKIs), although effective in kinase ablation, do not eliminate FLT3-ITD+ leukemia stem cells (LSCs) which are potential sources of disease relapse, prompting us to ask whether FLT3-ITD protein regulates the AML LSCs survival through a kinase-independent mechanism. Here, we show that expression of PRMT1, the primary type I arginine methyltransferase, significantly increases in LSC-enriched CD34+CD38- populations relative to normal counterparts. Genetic PRMT1 depletion blocked AML CD34+ cell survival, and had more potent effects in AML cells from patients harboring FLT3-ITD. Our genome wide analysis of gene expression and PRMT1 conditional KO mouse study confirmed that PRMT1 preferentially cooperates with FLT3-ITD contributing to AML cell maintenance. Mechanistically, PRMT1 catalyzed FLT3-ITD protein methylation at arginines 972/973, and PRMT1 promoted leukemia cell growth in a FLT3 methylation-dependent manner. Moreover, effects of FLT3-ITD methylation in AML cells were in part due to crosstalk with FLT3-ITD phosphorylation at tyrosine 969 (Y969). Importantly, FLT3 methylation persisted in FLT3-ITD+ AML cells following TKI (AC220) treatment, indicating that methylation occurs independently of kinase activity. Finally, in both patient-derived xenograft (PDX) and murine AML models, combined administration of AC220 with a type I PRMT inhibitor (MS023) enhanced elimination of FLT3-ITD+ AML relative to AC220 treatment alone. Our study demonstrates that PRMT1-mediated FLT3 methylation promotes LSC activity and suggests that combining PRMT1 inhibition with FLT3 TKI treatment could be a promising approach to selectively target FLT3-ITD+ LSCs.

2021-11-10 | GSE122435 | GEO

CircMYBL2 Regulates FLT3-ITD FLT3AML Translation in AML

Project description:CircMYBL2 is more highly expressed in AML patients with FLT3-ITD mutations than in those without the FLT3-ITD mutation. We found that circMYBL2 knockdown specifically inhibits proliferation and promotes the differentiation of FLT3-ITD AML cells in vitro and in vivo. We used the ribosome profiling and RNA-seq libraries sequenced with Illumina HiSeq 2500 to identify the mRNA that circMYBL2 targeted. Interestingly, we found that circMYBL2 significantly influences the protein level of mutant FLT3 kinase, which contributes to the activation of FLT3-ITD-dependent signaling pathways. Mechanistically, circMYBL2 enhanced the translational efficiency of FLT3 kinase by increasing the binding of PTBP1 to FLT3 mRNA. Moreover, circMYBL2 knockdown impaired the cytoactivity of inhibitor-resistant FLT3-ITD-positive cells, with a significant decrease in FLT3 kinase expression, followed by the inactivation of its downstream pathways. In summary, we are the first to reveal a circRNA that specifically influences FLT3-ITD AML and regulates FLT3 kinase levels through translational regulation, suggesting that circMYBL2 may be a potential therapeutic target for FLT3-ITD AML.

2019-07-09 | GSE133925 | GEO

FLT3 inhibition upregulates HDAC8 via FOXO to inactivate p53 and promote maintenance of FLT3-ITD+ acute myeloid leukemia

Project description:Internal tandem duplication (ITD) mutations within the FMS-like receptor tyrosine kinase-3 (FLT3) can be found in up to 25~30% of acute myeloid leukemia (AML) patients and confer a poor prognosis. Although FLT3 tyrosine kinase inhibitors (TKIs) have shown clinical responses, the overall outcome of FLT3-ITD+ AML patients remains poor, and most of them would relapse very shortly. TKIs can not eliminate primitive FLT3-ITD+ AML cells, which are potential sources of relapse. Therefore, elucidating the mechanisms underlying FLT3-ITD+ AML maintenance and drug resistance is essential to develop novel, effective treatment strategies. Here, we demonstrate that FLT3 inhibition induces histone deacetylase 8 (HDAC8) upregulation through FOXO1 and FOXO3-mediated transactivation in FLT3-ITD+ AML cells. Upregulated HDAC8 deacetylates and inactivates p53, leading to leukemia maintenance and drug resistance upon TKIs treatment. Genetic or pharmacological inhibition of HDAC8 re-activates p53, abrogates leukemia maintenance and significantly enhances TKI-mediated elimination of FLT3-ITD+ AML cells. Importantly, in FLT3-ITD+ AML patient-derived xenograft models, the combination of FLT3 TKI (AC220) with a HDAC8 inhibitor (22d) significantly inhibits leukemia progression and effectively reduces primitive FLT3-ITD+ AML cells. Moreover, we extend these findings to an AML subtype harboring another tyrosine kinase activating mutation. In conclusion, our study demonstrates that HDAC8 upregulation as an important mechanism to resist TKIs and promote leukemia maintenance, and suggests that combining HDAC8 inhibition with TKI treatment could be a promising strategy to treat FLT3-ITD+ AML and other tyrosine kinase mutation-harboring leukemias.

2020-02-13 | GSE138057 | GEO

GRP94 rewires and buffers the FLT3-ITD signaling network and promotes survival of acute myeloid leukemic stem cells

Project description:Internal tandem duplications in the tyrosine kinase receptor FLT3 (FLT3-ITD) are among the most common lesions in acute myeloid leukemia (AML) and there exists a need for new forms of treatment. Using ex vivo drug sensitivity screening, we found that FLT3-ITD+ patient cells are particularly sensitive to HSP90 inhibitors. While it is well known that HSP90 is important for FLT3-ITD stability, we found that HSP90 family members play a much more complex role in FLT3-ITD signaling than previously appreciated. First, we found that FLT3-ITD activates the unfolded protein response (UPR), leading to increased expression of GRP94/HSP90B1. GRP94 rewires FLT3-ITD signaling by binding and retaining FLT3-ITD in the ER, where it aberrantly activates downstream signaling pathways. Second, HSP90 family proteins protect FLT3-ITD+ AML cells against apoptosis by alleviating proteotoxic stress, and treatment with HSP90 inhibitors results in proteotoxic overload that triggers UPR-induced apoptosis. Importantly, leukemic stem cells are strongly dependent upon HSP90 for their survival, and the HSP90 inhibitor ganetespib causes leukemic stem cell exhaustion in mouse PDX models. Taken together, our study reveals a molecular basis for HSP90 addiction of FLT3-ITD+ AML cells and provides a rationale for including HSP90 inhibitors in the treatment regime for FLT3-ITD+ AML.

2020-09-02 | PXD009423 | Pride

Antileukemic activity of the VPS34-IN1 inhibitor in acute myeloid leukemia

Project description:Acute myeloid leukemia (AML) is an aggressive disease with a poor prognosis. Vacuolar protein sorting 34 (VPS34) is a member of the phosphatidylinositol-3-kinase lipid kinase family that controls the canonical autophagy pathway and vesicular trafficking. Using a recently developed specific inhibitor (VPS34-IN1), we found that a VPS34 block induces apoptosis in AML cells but not in normal CD34+ hematopoietic cells. Complete and acute inhibition of VPS34 was required for the anti-leukemic activity of VPS34-IN1. This inhibitor also has pleiotropic effects against various cellular functions related to class III PI3K in AML cells that may explain their survival impairment. VPS34-IN1 inhibits basal and L-asparaginase-induced autophagy in AML cells. A synergistic cell death activity of this drug was also demonstrated. VPS34-IN1 was additionally found to impair vesicular trafficking and mTORC1 signaling. From an unbiased approach based on phosphoproteomic analysis, we identified that VPS34-IN1 specifically inhibits STAT5 phosphorylation downstream of FLT3-ITD signaling in AML. The identification of the mechanisms controlling FLT3-ITD signaling by VPS34 represents an important insight into the oncogenesis of AML and could lead to new therapeutic strategies.

2020-11-11 | PXD016839 | Pride

GSK-3A and GSK-3B knockdown in AML cell lines

Project description:Gene expression data from AML cell lines, MOLM-14, U937, THP-1 and HL-60, that were infected with a scrambled control hairpin (shControl), two shRNAs directed against GSK-3B (shGSK3B_1 and shGSK3B_2), or two shRNAs directed against GSK-3A (shGSK3A_5 and shGSK3A_6). Acute myeloid leukemia (AML) is the most common form of acute leukemia in adults. Long-term survival of patients with AML has changed little over the past decade, necessitating the identification and validation of new AML targets. Integration of genomic approaches with small-molecule and genetic-based high-throughput screening holds the promise of improved discovery of candidate targets for cancer therapy. Here, we identified a role for glycogen synthase kinase 3A (GSK-3A) in AML by performing two independent small-molecule library screens and an shRNA screen for perturbations that induced a differentiation expression signature in AML cells. GSK-3 is a serine-threonine kinase involved in diverse cellular processes including differentiation, signal transduction, cell cycle regulation, and proliferation. We demonstrated that specific loss of GSK-3A induced differentiation in AML by multiple measurements, including induction of gene expression signatures, morphological changes, and cell surface markers consistent with myeloid maturation. GSK-3AM-bM-^@M-^Sspecific suppression also led to impaired growth and proliferation in vitro, induction of apoptosis, loss of colony formation in methylcellulose, and anti-AML activity in vivo. Although the role of GSK-3B has been well studied in cancer development, these studies support a role for GSK-3A in AML. The AML cell lines, MOLM-14, U937, THP-1 and HL-60, were infected with a scrambled control hairpin (shControl), two shRNAs directed against GSK-3B (shGSK3B_1 and shGSK3B_2), and two shRNAs directed against GSK-3A (shGSK3A_5 and shGSK3A_6).

2012-02-27 | E-GEOD-35200 | biostudies-arrayexpress

Microenvironmental CXCL12 Deletion Enhances Flt3-ITD Acute Myeloid Leukemia Stem Cell Response to Therapy by Reducing p38 MAPK Signaling

Project description:Fms-like tyrosine kinase 3 (Flt3) tyrosine kinase inhibitors (Flt3-TKI) have improved outcomes for patients with Flt3-mutated acute myeloid leukemia (AML) but are limited by resistance and relapse, suggesting persistence of leukemia stem cells (LSC). Here we utilized a Flt3-internal tandem duplication (Flt3-ITD) and Tet2-deleted AML genetic mouse model to characterize Flt3-ITD AML LSC and their resistance to Flt3-TKI. We show that LSC were enriched within the primitive ST-HSC population. CXCl12-expressing osteoprogenitors were increased in the Flt3-ITD AML marrow and FLT3-ITD LSC showed increased expression of the CXCL12 receptor CXCR4. CXCL12 deletion from the microenvironment enhanced AML targeting by combined Flt3-TKI and chemotherapy treatment with enhanced LSC targeting. We found that both treatment and CXCL12 deletion partially reduced p38 mitogen-activated protein kinase (p38) signaling with increased, but not complete, reduction seen with combined treatment and CXCL12 deletion. Our studies suggest that p38 contributes to CXCL12-mediated maintenance of AML LSC following Flt3-TKI and chemotherapy treatment, but that p38 inhibition enhances AML LSC response to treatment to a greater extent than CXCL12 deletion alone. This study supports a role for p38 signaling in CXCL12-mediated protection of AML LSC from treatment and provide a rationale for targeting p38 signaling to enhance Flt3-ITD AML targeting.

2024-01-03 | GSE212428 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data