Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

ABSTRACT: Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

ORGANISM(S): Homo sapiens

SUBMITTER: Yu Chen

PROVIDER: E-GEOD-46329 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:Fanconi anemia (FA) is a genetic disorder characterized by congenital abnormalities, bone marrow failure and increased susceptibility to cancer. Of the fifteen FA proteins, Fanconi anemia group C (FANCC) is one of eight FA core complex components of the FA pathway. Unlike other FA core complex proteins, FANCC is mainly localized in the cytoplasm, where it is thought to function in apoptosis, redox regulation, cytokine signaling and other processes. Previously, we showed that regulation of FANCC involved proteolytic processing during apoptosis. To elucidate the biological significance of this proteolytic modification, we searched for molecular interacting partners of proteolytic FANCC fragments. Among the candidates obtained, the transcriptional corepressor protein C-terminal binding protein-1 (CtBP1) interacted directly with FANCC and other FA core complex proteins. Although not required for stability of the FA core complex or ubiquitin ligase activity, CtBP1 is essential for proliferation, cell survival and maintenance of chromosomal integrity. Expression profiling of CtBP1-depleted and FA-depleted cells revealed that several genes were commonly up- and down-regulated, including the Wnt antagonist Dickkopf-1 (DKK1). These findings suggest that FA and Wnt signaling via CtBP1 could share common effectors. HeLa cell line was grown in DMEM media supplemented with 10% FBS and were incubated in 5% CO2 at 37Â°C. A four-plasmid (pRSV-Rev, pMDLg/pRRE, pMD2.G and pLKO.1) expression system was used for lentiviral production. Different pLKO.1 plasmids carrying shRNAs targeting FANCA, FANCD2, CtBP1 or CtBP2 or a lentiviral control vector pLKO.1-scrambled were used. Lentiviral particles were produced via calcium phosphate-mediated transient transfection of the four plasmids into HEK293T cells. Cells were exposed to appropriate lentiviral particles. In each experiment, HeLa cells were transduced for 6 hours with filtered supernatant containing recombinant lentiviral particles. After transduction, the cells were cultured for 72 hours. Total RNA extracts from 3 different samples of each scrambled, CtBPs and FANCD2 shRNA treated HeLa cells were subjected to gene expression profiling via microarray analysis. Gene expression profiles were determined with Affymetrix GeneChipÂ® Human Gene 1.0.

Dataset Information

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets