Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

ABSTRACT: Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

ORGANISM(S): Homo sapiens

PROVIDER: GSE46329 | GEO | 2013/05/10

SECONDARY ACCESSION(S): PRJNA202375

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Gene expression profiling of prostate cancer cells upon JMJD2A or ETV1 knockdown

Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells. Total RNA was isolated from transformed LNCaP human prostate cancer cells containing a non-trageting control vector (sh-cm), vectors containing shRNA sequences for JMJD2A or ETV1 genes.

2014-01-01 | E-GEOD-47750 | biostudies-arrayexpress

Transcriptional effect of ETV1 knockdown in melanoma cells

Project description:ETV1 is amplified in a subset of melanomas. Here, we performed RNA-seq on two BRAF V600E mutant melonoma cell lines transduced with a scrambed shRNA and two individual ETV1 shRNA

2018-04-15 | GSE80352 | GEO

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

2013-03-01 | GSE39355 | GEO

Gene expression profile of 22RV1 prostate cancer cells upon SPINK1 knockdown

Project description:Serine Peptidase Inhibitor, Kazal type 1 (SPINK1) overexpression represents the second-largest prostate cancer (PCa) subtype associated with increased risk of biochemical recurrence and poor prognosis. To determine the pathways regulated by SPINK1 in 22RV1 prostate cancer cells, we performed shRNA mediated knockdown of SPINK1 using lentiviral constructs. Scrambled shRNA was used as a control. pGIPZ constructs against SPINK1 (shSPINK1-1, shSPINK1-2, shSPINK1-3) and control shScrambled construct were purchased from Dharmacon.

2019-12-16 | GSE124345 | GEO

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy.

2013-03-01 | GSE39357 | GEO

Expression data from LNCap cell line treated with COP1 (RFWD2), ETV1, and JUN siRNAs

Project description:The proto-oncogenes ETV1, ETV4, and ETV5 encode members of the E26 transformation-specific (ETS) transcription factor family, which includes the most frequently rearranged and overexpressed genes in prostate cancer. Despite being critical regulators of development, little is known about their post-translational regulation. Here we identify the ubiquitin ligase COnstitutive Photomorphogenic-1 (COP1, also called RFWD2) as a tumor suppressor that negatively regulates ETV1, ETV4, and ETV5. ETV1, which is the member mutated more frequently in prostate cancer, was degraded after being ubiquitinated by COP1. Truncated ETV1 encoded by prostate cancer translocation TMPRSS2:ETV1 lacks the critical COP1 binding motifs (degrons) and was 50-fold more stable than wild-type ETV1. Almost all patient translocations eliminate these ETV1 degrons, implying that translocations rendering ETV1 insensitive to COP1 confer a significant selective advantage to prostate epithelial cells. Indeed, COP1 deficiency in mouse prostate elevated ETV1 levels and produced increased cell proliferation, hyperplasia, and early prostate intraepithelial neoplasia. The combined loss of COP1 and PTEN enhanced the invasiveness of mouse prostate adenocarcinomas. Finally, relatively rare human prostate cancer samples showed hemizygous loss of the COP1 gene, loss of COP1 protein expression, and abnormally elevated ETV1 protein while lacking a translocation event. These findings identify COP1 as a bona fide tumor suppressor whose down-regulation promotes prostatic epithelial cell proliferation and tumorigenesis.

2011-04-08 | GSE27914 | GEO

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine mouse prostate cells from WT mice with s with T-ETV1 mice, which contains express the truncated human ETV1 under the endogenous Tmprss2 promoter. ETV1 expression can be tracked by GFP expression. Primary prostate cells were isolated and luminal prostate cells were FACS-sorted by CD49F+ Sca1- from the lineage (CD31, CD45, Ter119) negative fraction. Total RNA was extracted from three biological replicates, and amplified using NuGEN V2cDNA amplification kit. This was used to hybridize to Affymetrix expression arrays using the Mouse Genome 430 2.0 platform.

2013-03-01 | E-GEOD-39355 | biostudies-arrayexpress

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell.

2013-03-01 | GSE39353 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data