Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Ultra-deep RNA-seq of in vitro and in vivo transcripts by Escherichia coli RNA polymerase

ABSTRACT: We report a high-resolution Illumina RNA-seq method that can analyze non-coded base substitutions in mRNA at 10(-4)-10(-5) per base frequencies in vitro and in vivo. The RNA samples were generated by transcription of pPR9 plasmid that contains a 5.7 kb fragment of E. coli rpoBC operon transcribed from a strong lambda phage PR promoter and terminated at an fd phage transcription terminator. The reference transcription reaction was performed in a buffer with 5 mM MgCl2 to determine the standard error rate (barcode 1). To reduce fidelity, we replaced Mg2+ with Mn2+ (barcode 2). To increase fidelity, we added GreA/GreB proteins for proofreading activity (barode 3 and 4). The same transcrit was purified from E. coli cells (barcode 5).

ORGANISM(S): Escherichia coli

SUBMITTER: Masahiko Imashimizu

PROVIDER: E-GEOD-46479 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Direct assessment of transcription fidelity by high-resolution RNA sequencing.

Imashimizu Masahiko M Oshima Taku T Lubkowska Lucyna L Kashlev Mikhail M

Nucleic acids research 20130807 19

Cancerous and aging cells have long been thought to be impacted by transcription errors that cause genetic and epigenetic changes. Until now, a lack of methodology for directly assessing such errors hindered evaluation of their impact to the cells. We report a high-resolution Illumina RNA-seq method that can assess noncoded base substitutions in mRNA at 10(-4)-10(-5) per base frequencies in vitro and in vivo. Statistically reliable detection of changes in transcription fidelity through ∼10(3) nt ...[more]

PMID: 23925128

Similar Datasets

CRISPR enhancer scan to detect critical elements for the regulation of EVI1 in a translocated enhancer

Project description:To uncover, in an unbiased fashion, which elements of the 18 kb translocated region control EVI1 transcription, we devised a CRISPR/Cas9-based enhancer scanning approach. We considered all possible sgRNA target sites containing a canonical Cas9 PAM site (NGG) on both strands of the minimal 18 kb translocated region. Deep-sequencing libraries were generated by PCR amplification of sgRNA guide strands using primers that tag the product with standard Illumina adapters and a 4 bp sample barcode in a 2 step-PCR protocol.

2021-07-26 | E-MTAB-9948 | biostudies-arrayexpress

Comparative genomic hybridization of yeast to determine size characteristics of yeast haploid deletion strains separated by elutriation

Project description:Determination of size characteristics of pools of yeast haploid deletion strains by elutriation and barcode analysis.

2008-02-15 | E-MEXP-1200 | biostudies-arrayexpress

Scalable Microfluidics for Single Cell RNA Printing and Sequencing

Project description:Single cell transcriptomics has emerged as a powerful approach to dissecting phenotypic heterogeneity in complex, unsynchronized cellular populations. However, many important biological questions demand quantitative analysis of large numbers of individual cells. Hence, new tools are urgently needed for efficient, inexpensive, and parallel manipulation of RNA from individual cells. We report a simple microfluidic platform for trapping single cell lysates in sealed, picoliter microwells capable of “printing” RNA on glass or capturing RNA on polymer beads. To demonstrate the utility of our system for single cell transcriptomics, we developed a highly scalable technology for genome-wide, single cell RNA-Seq. The current implementation of our device is pipette-operated, profiles hundreds of individual cells in parallel with library preparation costs of ~$0.10-$0.20/cell, and includes five lanes for simultaneous experiments. We anticipate that this system will ultimately serve as a general platform for large-scale single cell transcriptomics, compatible with both imaging and sequencing readouts.!Series_type = Expression profiling by high throughput sequencing A microfluidic device that pairs sequence-barcoded mRNA capture beads with individual cells was used to barcode cDNA from individual cells which was then pre-amplified by in vitro transcription in a pool and converted into an Illumina RNA-Seq library. Libraries were generated from ~600 individual cells in parallel and extensive analysis was done on 396 cells from the U87 and MCF10a cell lines and from ~500 individual cells with extensive analysis on 247 cells from the U87 and WI-38 cell lines. Sequencing was done on the 3'-end of the transcript molecules. The first read contains cell-identifying barcodes that were present on the capture bead and the second read contains a unique molecular identifier (UMI) barcode, a lane-identifying barcode, and then the sequence of the transcript.

2015-05-21 | E-GEOD-66357 | biostudies-arrayexpress

Transcriptomics reveals the role of NHEJ in mycobacterial antiphage defense

Project description:In the ongoing arms race with phages, bacteria have evolved diverse defense systems, such as CRISPR-Cas and restriction-modification systems. The DNA double-strand break (DSB) repair system represents a core mechanism for maintaining genomic integrity and is vital for cell survival. However, it remains unknown whether and how these repair systems contribute to phage resistance. This study systematically investigates the role of the non-homologous end joining (NHEJ) during phage infection in Mycobacterium smegmatis. We found that NHEJ deficiency compromises host resistance to phage SWU1, as evidenced by increased plaque counts and reduced bacterial survival. Mechanistically, phages exploit host NHEJ for genomic repair; however, the error-prone nature of NHEJ leads to imperfect repair at phage cos sites, thereby blocking replication. The host modulates the balance between NHEJ and homologous recombination (HR) to control repair fidelity: NHEJ loss shifts the balance towards high-fidelity HR, which in turn promotes phage survival. Furthermore, NHEJ deficiency exacerbates infection-induced oxidative stress, leading to a compromise in bacterial viability. Our findings reveal the multifaceted functions of NHEJ in mycobacterium-phage interactions and provide new insights into how DNA repair systems shape antiphage defense and coevolution.

2026-01-01 | GSE315142 | GEO

Targeted sequencing of reporter transcripts with variable GA-multivalency and intron content

Project description:These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. The reporter pool was expressed either via plasmid transfection or from a dox-incudible promoter. Cells were then fractionated to obtain nuclear and cytoplasmic RNA, and the barcode sequences were amplified to determine the abundance of each different reporter transcript in each fraction. Experiments were performed in triplicate and the nuclear and cytoplasmic fractions for all replicates were multiplexed into one file, which is provided here. Different expression times were sampled to determine how nuclear/cytoplasmic localisation changed in response to changes in PPIG-LCD protein accumulation. In one instance, the effect of the CLK inhibitor CLK-IN-T3 was tested. Multiple experimental conditions are provided: Experiment 1: transfection for 16 hours. Experiment 2: transfection for either 8 or 24 hours. Experiment 3: dox-induction for either 4, 8, or 12 hours. Note: expression kinetics are faster with dox induction than transfection. Experiment 4: dox-induction for 6 hours, either with 1 uM CLK-IN-T3 treatment, or with equivalent volume DMSO. Treatment began 2 hours before dox-induction. Each correct read in each sample should contain the following sequences in the following order: UMIs (N) and experimental barcodes (B): NNNNNBBBBNNNNN A fixed sequence: GGCCTGCGGATCC A unique plasmid barcode, which identifies the reporter transcript: NNNNNNNNNNNNNNNNNNNN A fixed sequence: GTTGTCGATCGAGACGTAAT Illumina adapter sequences. The experimental barcode arrangement for each sample is provided as a supplement to this accession.

2025-07-29 | E-MTAB-13329 | biostudies-arrayexpress

shRNA profiling of human breast carcinoma cells expressing over 300 shRNA constructs using barcode tiling arrays - screens 2 and 3

Project description:RNAi screens via pooled short hairpin RNAs (shRNAs) have recently become a powerful tool for the identification of essential genes in mammalian cells. We synthesized DNA microarrays with six overlapping 25 nt long tiling probes complementary to each unique 60 nt molecular barcode sequence associated with every shRNA expression construct.. In this part of the study pooled shRNAs were transduced into MDA-MB-231 breast carcinoma cell lines and their inhibitory effects four weeks post transduction were analyzed via microarray hybridization.

2009-12-08 | E-MEXP-2477 | biostudies-arrayexpress

shRNA profiling of human breast carcinoma cells expressing over 300 shRNA constructs using barcode tiling arrays - screen 1

2009-12-08 | E-MEXP-2476 | biostudies-arrayexpress

shRNA profiling of human cells containing varying concentrations of shRNA expression constructs to determine shRNA abundance using half hairpin sequences

Project description:RNAi screens via pooled short hairpin RNAs (shRNAs) have recently become a powerful tool for the identification of essential genes in mammalian cells. We synthesized DNA microarrays with six overlapping 25 nt long tiling probes complementary to each unique 60 nt molecular barcode sequence associated with every shRNA expression construct. By analyzing dilution series of expression constructs we show how our approach allows quantification of shRNA abundance from a pool and how it clearly outperforms the commonly used analysis via the shRNAs half hairpin sequences. In this part of the study one equimolar reference pool and three test pools of varying template concentrations were PCR amplified and hybridized to individual arrays.

2009-12-08 | E-MEXP-2475 | biostudies-arrayexpress

shRNA profiling of human cells containing varying concentrations of shRNA expression constructs to determine shRNA abundance using barcodes

Project description:RNAi screens via pooled short hairpin RNAs (shRNAs) have recently become a powerful tool for the identification of essential genes in mammalian cells. We synthesized DNA microarrays with six overlapping 25 nt long tiling probes complementary to each unique 60 nt molecular barcode sequence associated with every shRNA expression construct. By analyzing dilution series of expression constructs we show how our approach allows quantification of shRNA abundance from a pool and how it clearly outperforms the commonly used analysis via the shRNAs half hairpin sequences. In this part of the study one equimolar reference pool and three test pools of varying template concentrations were PCR amplified and hybridized to individual arrays.

2009-12-08 | E-MEXP-2474 | biostudies-arrayexpress

Identification of radiation resistence genes by shRNA screen

Project description:To identify genes involved in raditaion resistence in glioblastoma, Decode shRNA Viral screening was performed on U87MG and LN229 glioblastoma cell lines. Cells were irraidated with 2 Gy and then compared to unirradiated cell genomic DNA on Decode custom Agilent barcode arrays.

2015-01-06 | E-MTAB-2861 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data