Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

54 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profile of Pten loss and ERG overexpression in mouse prostate

ABSTRACT: We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected. Mice are in the C57B6 background. The prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.

ORGANISM(S): Mus musculus

SUBMITTER: Yu Chen

PROVIDER: E-GEOD-46799 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Response to catration in PTEN null and PTEN null ERG expressing mouse prostates

Project description:We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration. Mice are in the C57B6 background. Two mice in each group were castrated. Three days after castration, the prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.

2013-04-25 | E-GEOD-46360 | biostudies-arrayexpress

Expression profile of Pten loss and ERG overexpression in mouse prostate

Project description:We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice. For WT and ERG prostates, entire prostates were dissected and total RNA immediated harvested. For Pten f/f and Pten f/f;ERG prostates, the Ventral Lobe was dissected.

2013-05-10 | GSE46799 | GEO

PTEN intact and NULL prostates in intact and castrate mice.

Project description:We performed expression profiling of prostates of 3 month wild-type and PTEN NULL mice and assessed the response to 3 days of castration. Seven three month old WT and PbCre x PTEN f/f (PTEN NULL) mice were used. They are in the C57B6 background. Three mice in each group were castrated. Three days after castration, the prostate were harvested and RNA isolated by standard protocols and analyzed by expression profiling.

2011-05-19 | E-GEOD-24691 | biostudies-arrayexpress

Response to catration in PTEN null and PTEN null ERG expressing mouse prostates

Project description:We performed expression mouse profiling of prostates of 3 month PTEN f/f and Pten f/f;R26(ERG) mice and assessed the response to 3 days of castration.

2013-04-25 | GSE46360 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2013-05-30 | E-GEOD-47220 | biostudies-arrayexpress

Genomic mapping of ERG, AR, histone H3 monomethyl-K4, histone H3 trimethyl-K4 binding sites in mouse prostates in WT, ERG overexpression, Pten loss mouse prostates

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. We generated a mouse model of ERG ovexpression (Rosa26-ERG) which when crossed into prostate specific probasin-Cre, expressed ERG specifically in the prostate. We crossed Rosa26-ERG into Pten flox/flox allele to generate compound GEMM mouse. Here, we determined the genomic binding sites of ERG, AR, and the histone marks H3K4me1 and H3K4me3 that maps enhancers and promoters respectively in the prostates of these mice.

2013-06-13 | GSE47119 | GEO

Genomic mapping of ERG, AR, histone H3 monomethyl-K4, histone H3 trimethyl-K4 binding sites in mouse prostates in WT, ERG overexpression, Pten loss mouse prostates

2013-06-13 | E-GEOD-47119 | biostudies-arrayexpress

Expression data from regenerating prostates of wild-type or Gli1-/- mutant mice

Project description:Attenuation of Hedgehog (Hh) pathway activity leads to increased prostate branching during adult prostate regeneration. In order to identify genes regulated by the Hh pathway that might be involved in adult prostate branching, we performed transcriptional profiling of regenerating prostates from wild-type or Gli1-/- mutant mice, which have attenuated Hh pathway activity. 6 total samples were analyzed. 3 wild-type prostates and 3 Gli-/- mutant prostates were analyzed.

2014-10-31 | E-GEOD-59849 | biostudies-arrayexpress

Transcription profiling of prostates from normal and Pten knock-out mice, and comparing the gene expression profile in the proximal and distal part of normal prostates

Project description:1. Comparison of gene expression profiles of normal prostates and prostates isolated from 4-5 months old PSA-Cre;Pten-loxP/loxP mice<br>2.Comparison of the gene expression profile in the proximal and distal part of normal prostates

2009-08-07 | E-MEXP-2029 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data