Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

ABSTRACT: Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq. To determine ETV1 and H3K4me1 localization, logarithmically growing cells

ORGANISM(S): Homo sapiens

SUBMITTER: Yu Chen

PROVIDER: E-GEOD-47120 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Mapping of ETV1 genomic binding sites in gastrointestinal stromal tumor (GIST).

Project description:ETV1 is highly expressed in GIST and their presumed precursors--the interstitial cells of Cajal. ETV1 is required for survival for both GIST and ICC and regulates GIST signature genes. Here, using Illumina-Solexa based next-generation sequencing of ETV1 chromatin immunoprecipates (ChIP-Seq), we define ETV1 binding sites in the GIST48 cell line. Crosslinked ChIP using input control ETV1 ChIP in GIST48 cells. Details: GIST48 cells were crosslinked for 15-minutes in 1% parformaldehyde. Cells were lysed and chromatin sheared using bioruptor. Sheared chromatin was incubated with anti-rabbit IgG dynabeads pre-conjugated with anti-ETV1 antibody (Abcam Ab81086, Lot 787879), washed, eluted, reverse cross-linked, and purified. Purified ChIP DNA was blunt-ended, ligated to Solexa adaptors, amplified with 18-cycles of PCR, and sequenced on Solexa Genome Analyzer. All reads (~36-bp) from ChIP-Seq were aligned to the human genome (build 36, or hg18) using the ELAND alignment software within the Illumina Analysis Pipeline. Unique reads mapped to a single best-matching location with no more than two mismatches were kept and used to generate genome-wide distribution of ETV1-binding and for peak identification. Redundant reads were considered once.

2010-10-14 | E-GEOD-22441 | biostudies-arrayexpress

Effect of ETV1 knockdown on genome wide AR binding in LNCaP Cells

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. LNCaP cells harbor an ETV1 translocation. We performed ChIP-Seq analysis to determine the role of ETV1 on AR binding. The localization of enhancers were determined by H3K4me1 ChIP-Seq.

2013-06-13 | GSE47120 | GEO

Genomic mapping of ERG, AR, histone H3 monomethyl-K4, histone H3 trimethyl-K4 binding sites in mouse prostates in WT, ERG overexpression, Pten loss mouse prostates

Project description:Translocation of ETS transcription factors including ERG and ETV1 occur in half of all prostate cancers. We generated a mouse model of ERG ovexpression (Rosa26-ERG) which when crossed into prostate specific probasin-Cre, expressed ERG specifically in the prostate. We crossed Rosa26-ERG into Pten flox/flox allele to generate compound GEMM mouse. Here, we determined the genomic binding sites of ERG, AR, and the histone marks H3K4me1 and H3K4me3 that maps enhancers and promoters respectively in the prostates of these mice. The prostate of four six month old mice of each genotype were pooled. The chromatin was isolated and ChIP-Seq performed.

2013-06-13 | E-GEOD-47119 | biostudies-arrayexpress

ChIP-Seq of Histone H3K4me1 and H3K4me3 in human GIST48 cells

Project description:We previously mapped ETV1 using ChIP-Seq in GIST48 cells (GSE22441). Here, we map the enhancer landscape marked by histone H3K4me1 and the promoter landscape marked by histone H3K4me3 in GIST48 cells. Crosslink ChIP-Seq of H3K4me1 and H3K4me3 in GIST48 cells

2015-01-01 | E-GEOD-64609 | biostudies-arrayexpress

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

ETV1 ChIP-seq in OE33 esophageal adenocarcinoma cells

Project description:Chromatin immunoprecipitation using anti-ETV1 a.k.a. ER81 (Abcam: ab81086) antibodies or input DNA in an OE33 cell line

2017-07-07 | E-MTAB-5168 | biostudies-arrayexpress

Profiling of RWPE cells stably over-expressing ETV1

Project description:RWPE benign prostatic epithelial cells were infected with a lentivirus expressing ETV1 or GUS (control), and stable clones were isolated by puromycin selection. ETV1 over-expression, recapitulating ETS gene rearrangements observed in vivo, confers invasiveness in the benign prostate cell line RWPE. Keywords: genetic modification Four hybridizations in total were performed using RWPE cells stably expressing ETV1 or GUS (control) on Agilent Whole Human Genome Oligonucleotide Microarrays. RWPE-ETV1 (Cy5) / RWPE-GUS (Cy3) and a dye flip were performed in duplicate

2010-05-27 | E-GEOD-7701 | biostudies-arrayexpress

Mitochondrial Membrane Potential Regulates Nuclear Gene Expression in Macrophages Exposed to PGE2

Project description:Metabolic engagement is intrinsic to immune cell function. Prostaglandin E2 (PGE2) has been shown to modulate macrophage activation, yet how PGE2 might affect metabolism is unclear. Here we show that PGE2 causes mitochondrial membrane potential (Δψm) to dissipate in interleukin-4 activated macrophages (M(IL-4)). Effects on Δψm are a consequence of PGE2-initiated transcriptional regulation of genes in the malate-aspartate shuttle (MAS), particularly GOT1. Reduced Δψm causes alterations in the expression of 126 voltage regulated genes (VRGs) including Resistin like molecule-α (RELMα), a key marker of M(IL-4), and genes that regulate cell cycle, The transcription factor ETS variant 1 (ETV1) plays a role in the regulation of 38% of the VRGs. These results reveal ETV1 as a Δψm-sensitive transcription factor, and Δψm as a mediator of mitochondrial-directed nuclear gene expression.

2021-09-08 | PXD010997 | Pride

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy. Genomic targets of ERG and ETV1 transcription factors were identified by antibody-mediated and biotin-mediated ChIP-chip in human VCaP and LNCaP cells, respectively.

2013-03-01 | E-GEOD-39357 | biostudies-arrayexpress

Gene expression profiling of prostate cancer cells upon JMJD2A or ETV1 knockdown

Project description:Gene expression profiling of LNCaP prostate cancer cells that have JMJD2A knockdown (JMJD2A shRNA #3; JMJD2A shRNA #5) or ETV knockdown (ETV shRNA #1; ETC shRNA #5) were compared to non-targeted control (sh-cm) cells. Total RNA was isolated from transformed LNCaP human prostate cancer cells containing a non-trageting control vector (sh-cm), vectors containing shRNA sequences for JMJD2A or ETV1 genes.

2014-01-01 | E-GEOD-47750 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data