Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

ABSTRACT: The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.

ORGANISM(S): Arabidopsis thaliana

SUBMITTER: Nathan Berkowitz

PROVIDER: E-GEOD-47121 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes--GMUCT 2.0.

Willmann Matthew R MR Berkowitz Nathan D ND Gregory Brian D BD

Methods (San Diego, Calif.) 20130715 1

The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods-genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing-take advantage of the fact that Illumina sequencing lib ...[more]

PMID: 23867340

Similar Datasets

Project description:MicroRNAs (miRNAs) are a class of small RNAs which typically function by guiding cleavage of target messenger RNAs. They have been shown to play major roles in a variety of plant processes including development, and responses to pathogens and environmental stresses. To identify new miRNAs and regulation in Arabidopsis thaliana, 27 small RNA libraries were constructed and sequenced from various tissues, stresses and small RNA biogenesis mutants, resulting in 95 million genome-matched sequences. The use of rdr2 to enrich the miRNA population greatly enhanced this analysis and led to the discovery of 44 new miRNAs arising from both known and new precursors. Parallel Analysis of RNA Ends (PARE) data provide evidence that the majority guide target cleavage. The inclusion of novel stress/tissue conditions, such as submergence-stressed flowers, enabled identification of new stress regulation of both miRNAs and their targets, all of which were validated in wild type plants. By combining small RNA expression analysis with ARGONAUTE (AGO) immunoprecipitation data and global target cleavage data from PARE, a much more complete picture of Arabidopsis miRNAs was obtained. This combinatorial approach led to the discovery of AGO loading and target cleavage biases, which gave important insights into tissue-specific expression patterns, pathogen responses and the role of sequence variation among closely related miRNA family members. Examination of various tissues, stresses and small RNA biogenesis mutants in Arabidopsis by high-throughput sequencing for small RNA profiling. We have used AGO-IP and PARE data from the published data, which were downloaded from NCBI GEO with the following accession number. AGO-IP from GSM253622, GSM707682, GSM642335, GSM642336, GSM512703, GSM512702, GSM707683, GSM707684, GSM707685, GSM149080, GSM253623, GSM304283, GSM642337, GSM642338, GSM253624, GSM415788, GSM707686, GSM707687, GSM707688, GSM707689, GSM415787, GSM149081, GSM253625, GSM415789, GSM415790, GSM304285, GSM415791, GSM415792 PARE sequencing data from xrn4 flowers were obtained from Gene Expression Omnibus with accession number GSM280227.

Dataset Information

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

Publications

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes--GMUCT 2.0.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets