Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Ribonuclease L and Metal-Ion-Independent Endoribonuclease Cleavage Sites in Host and Viral RNAs

ABSTRACT: We used 2', 3'-cyclic phosphate cDNA synthesis and Illumina sequencing to identify and quantify metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs. To make cDNA libraries, we exploited the 2’, 3’-cyclic phosphate at the end of RNA fragments produced by RNase L and other metal-ion-independent endoribonucleases. Using Arabidopsis thaliana tRNA ligase, RNA fragments with 2’, 3’-cyclic phosphates were covalently attached to defined RNA linkers containing an 8-base long unique molecular identifier (UMI) sequence. Libraries prepared in this manner contain cDNA derived exclusively from RNA fragments with 2', 3'-cyclic phosphates. The UMI sequence allows for detailed quantitation. We optimized and validated 2’, 3’-cyclic phosphate cDNA synthesis and Illumina sequencing methods using viral RNAs cleaved with purified RNase L, viral RNAs cleaved with purified RNase A, and RNA from uninfected and poliovirus-infected HeLa cells.

ORGANISM(S): Homo sapiens

SUBMITTER: Daphne Cooper

PROVIDER: E-GEOD-52489 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs.

Cooper Daphne A DA Jha Babal K BK Silverman Robert H RH Hesselberth Jay R JR Barton David J DJ

Nucleic acids research 20140205 8

Ribonuclease L (RNase L) is a metal-ion-independent endoribonuclease associated with antiviral and antibacterial defense, cancer and lifespan. Despite the biological significance of RNase L, the RNAs cleaved by this enzyme are poorly defined. In this study, we used deep sequencing methods to reveal the frequency and location of RNase L cleavage sites within host and viral RNAs. To make cDNA libraries, we exploited the 2', 3'-cyclic phosphate at the end of RNA fragments produced by RNase L and ot ...[more]

PMID: 24500209

Similar Datasets

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.

Dataset Information

Ribonuclease L and Metal-Ion-Independent Endoribonuclease Cleavage Sites in Host and Viral RNAs

Publications

Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets