SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE54065 | GEO | 2014/01/15
SECONDARY ACCESSION(S): PRJNA234508
REPOSITORIES: GEO
Similar Datasets
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Internal tandem duplication (ITD) mutations within the FMS-like receptor tyrosine kinase-3 (FLT3) can be found in up to 25~30% of acute myeloid leukemia (AML) patients and confer a poor prognosis. Although FLT3 tyrosine kinase inhibitors (TKIs) have shown clinical responses, the overall outcome of FLT3-ITD+ AML patients remains poor, and most of them would relapse very shortly. TKIs can not eliminate primitive FLT3-ITD+ AML cells, which are potential sources of relapse. Therefore, elucidating the mechanisms underlying FLT3-ITD+ AML maintenance and drug resistance is essential to develop novel, effective treatment strategies. Here, we demonstrate that FLT3 inhibition induces histone deacetylase 8 (HDAC8) upregulation through FOXO1 and FOXO3-mediated transactivation in FLT3-ITD+ AML cells. Upregulated HDAC8 deacetylates and inactivates p53, leading to leukemia maintenance and drug resistance upon TKIs treatment. Genetic or pharmacological inhibition of HDAC8 re-activates p53, abrogates leukemia maintenance and significantly enhances TKI-mediated elimination of FLT3-ITD+ AML cells. Importantly, in FLT3-ITD+ AML patient-derived xenograft models, the combination of FLT3 TKI (AC220) with a HDAC8 inhibitor (22d) significantly inhibits leukemia progression and effectively reduces primitive FLT3-ITD+ AML cells. Moreover, we extend these findings to an AML subtype harboring another tyrosine kinase activating mutation. In conclusion, our study demonstrates that HDAC8 upregulation as an important mechanism to resist TKIs and promote leukemia maintenance, and suggests that combining HDAC8 inhibition with TKI treatment could be a promising strategy to treat FLT3-ITD+ AML and other tyrosine kinase mutation-harboring leukemias.
2020-02-13 | GSE138057 | GEO
Project description:Constitutively activating internal tandem duplication (ITD) alterations of the receptor tyrosine kinase FLT3 (Fms-like tyrosine kinase 3) are common in acute myeloid leukemia (AML) and classifies FLT3 as an attractive therapeutic target. So far, application of FLT3 small molecule inhibitors such as Sorafenib has resulted only in partial and transient clinical responses in FLT3-ITD+ patients. Only recently, a prolonged event-free survival has been observed in AML patients who were treated with Sorafenib in addition to standard therapy. Here, we studied the Sorafenib effect on proliferation in a panel of 13 FLT3-ITD- and FLT3-ITD+ AML cell lines. Sorafenib IC50 values ranged from 0.001 to 5.6 µM, whereas FLT3-ITD+ cells (MOLM-13, MV4;11) were found more sensitive to Sorafenib than FLT3-ITD- cells. However, we identified two FLT3-ITD- cell lines (MONO-MAC-1 and OCI-AML-2) which were also Sorafenib sensitive. Phosphoproteome analyses revealed that the affected pathways differed in Sorafenib sensitive FLT3-ITD- and FLT3-ITD+ cells. In MV4;11 cells Sorafenib suppressed mTOR signalling by inhibiting direct inhibition of FLT3. In MONO-MAC-1 cells Sorafenib inhibited the MEK/ERK pathway by inhibition of the RET tyrosine kinase. These data suggest that the FLT3 status in AML patients might not be the only predictive factor for a response to Sorafenib.
2017-05-02 | PXD004442 | Pride
Project description:The presence of FLT3-ITD mutations in patients with acute myeloid leukemia (AML) is associated with poor clinical outcome. FLT3 tyrosine kinase inhibitors (TKIs), although effective in kinase ablation, do not eliminate FLT3-ITD+ leukemia stem cells (LSCs) which are potential sources of disease relapse, prompting us to ask whether FLT3-ITD protein regulates the AML LSCs survival through a kinase-independent mechanism. Here, we show that expression of PRMT1, the primary type I arginine methyltransferase, significantly increases in LSC-enriched CD34+CD38- populations relative to normal counterparts. Genetic PRMT1 depletion blocked AML CD34+ cell survival, and had more potent effects in AML cells from patients harboring FLT3-ITD. Our genome wide analysis of gene expression and PRMT1 conditional KO mouse study confirmed that PRMT1 preferentially cooperates with FLT3-ITD contributing to AML cell maintenance. Mechanistically, PRMT1 catalyzed FLT3-ITD protein methylation at arginines 972/973, and PRMT1 promoted leukemia cell growth in a FLT3 methylation-dependent manner. Moreover, effects of FLT3-ITD methylation in AML cells were in part due to crosstalk with FLT3-ITD phosphorylation at tyrosine 969 (Y969). Importantly, FLT3 methylation persisted in FLT3-ITD+ AML cells following TKI (AC220) treatment, indicating that methylation occurs independently of kinase activity. Finally, in both patient-derived xenograft (PDX) and murine AML models, combined administration of AC220 with a type I PRMT inhibitor (MS023) enhanced elimination of FLT3-ITD+ AML relative to AC220 treatment alone. Our study demonstrates that PRMT1-mediated FLT3 methylation promotes LSC activity and suggests that combining PRMT1 inhibition with FLT3 TKI treatment could be a promising approach to selectively target FLT3-ITD+ LSCs.
2021-11-10 | GSE122435 | GEO
Project description:Fms-like tyrosine kinase 3 (Flt3) tyrosine kinase inhibitors (Flt3-TKI) have improved outcomes for patients with Flt3-mutated acute myeloid leukemia (AML) but are limited by resistance and relapse, suggesting persistence of leukemia stem cells (LSC). Here we utilized a Flt3-internal tandem duplication (Flt3-ITD) and Tet2-deleted AML genetic mouse model to characterize Flt3-ITD AML LSC and their resistance to Flt3-TKI. We show that LSC were enriched within the primitive ST-HSC population. CXCl12-expressing osteoprogenitors were increased in the Flt3-ITD AML marrow and FLT3-ITD LSC showed increased expression of the CXCL12 receptor CXCR4. CXCL12 deletion from the microenvironment enhanced AML targeting by combined Flt3-TKI and chemotherapy treatment with enhanced LSC targeting. We found that both treatment and CXCL12 deletion partially reduced p38 mitogen-activated protein kinase (p38) signaling with increased, but not complete, reduction seen with combined treatment and CXCL12 deletion. Our studies suggest that p38 contributes to CXCL12-mediated maintenance of AML LSC following Flt3-TKI and chemotherapy treatment, but that p38 inhibition enhances AML LSC response to treatment to a greater extent than CXCL12 deletion alone. This study supports a role for p38 signaling in CXCL12-mediated protection of AML LSC from treatment and provide a rationale for targeting p38 signaling to enhance Flt3-ITD AML targeting.
2024-01-03 | GSE212428 | GEO
Project description:Kinase hyperactivity is a common driver of acute myeloid leukemia (AML) and serves as a therapeutic target. The most frequent genetic aberration leading to hyperactive kinase signaling and poor prognosis is internal tandem duplication (ITD) of the FMS-tyrosine-like Kinase 3-gene (FLT3). FLT3-ITD induces ligand independent activation of FLT3 and downstream pathways leading to proliferation, decreased apoptosis and partial differentiation block. Combined with chemotherapy, FLT3-Tyrosine Kinase Inhibitor (FLT3-TKI) midostaurin improves overall survival (OS) of newly diagnosed FLT3-mutated AML patients, whereas single agent gilteritinib proved superior to chemotherapy in relapsed/refractory FLT3-mutated AML patients . As the primary targets of currently approved FLT3-TKIs are tyrosine (Y) kinases, we hypothesized that direct evaluation of tyrosine phosphorylation status could reveal pY phosphorylation profiles associated with FLT3-TKI response. Therefore, we used label-free pTyr-based phosphoproteomics in 35 primary AML samples (18 FLT3-WT, 17 FLT3-ITD), to identify differentially phosphorylated proteins underlying response to the FLT3-TKIs gilteritinib and midostaurin. We identified a total of 3024 unique phosphosites (median 1299 per sample, range 286 – 1612, pS:pT:pY 11.9%:9.5%:78.6%). Due to low number of identified phosphosites, we excluded two samples from further analyses. On the remaining 33 samples, we additionally performed IMAC global phosphoproteomics and on 17 samples protein expression analysis.
2021-09-10 | PXD024235 | Pride
Project description:Internal tandem duplications in the tyrosine kinase receptor FLT3 (FLT3-ITD) are among the most common lesions in acute myeloid leukemia (AML) and there exists a need for new forms of treatment. Using ex vivo drug sensitivity screening, we found that FLT3-ITD+ patient cells are particularly sensitive to HSP90 inhibitors. While it is well known that HSP90 is important for FLT3-ITD stability, we found that HSP90 family members play a much more complex role in FLT3-ITD signaling than previously appreciated. First, we found that FLT3-ITD activates the unfolded protein response (UPR), leading to increased expression of GRP94/HSP90B1. GRP94 rewires FLT3-ITD signaling by binding and retaining FLT3-ITD in the ER, where it aberrantly activates downstream signaling pathways. Second, HSP90 family proteins protect FLT3-ITD+ AML cells against apoptosis by alleviating proteotoxic stress, and treatment with HSP90 inhibitors results in proteotoxic overload that triggers UPR-induced apoptosis. Importantly, leukemic stem cells are strongly dependent upon HSP90 for their survival, and the HSP90 inhibitor ganetespib causes leukemic stem cell exhaustion in mouse PDX models. Taken together, our study reveals a molecular basis for HSP90 addiction of FLT3-ITD+ AML cells and provides a rationale for including HSP90 inhibitors in the treatment regime for FLT3-ITD+ AML.
2020-09-02 | PXD009423 | Pride
Project description:Treatment with inhibitors of the receptor tyrosine kinase FLT3 are currently studied as promising therapies in acute myeloid leukemia (AML). However, only a subset of patients benefit from these treatments and the presence of activating mutations within FLT3 can predict response to a certain extent only. AC220 (quizartinib) is an example of a potent FLT3 inhibitor1 that was studied in a recent phase II open-label study in patients with relapsed/refractory AML. The complete remission rate (including CRp and CRi) in FLT3-ITD-positive patients was 54% (50/92) and the corresponding partial remission rate (PR) was 17% (16/92)2 Thus, although the FLT3-ITD mutation status correlates with response, the error rate in stratification of patients into responders and non-responders is high, as still 29% of the FLT3-ITD-positive patients failed to respond. Exclusion of FLT3-ITD-negative patients from AC220 treatment also seems critical, as the total response rate (CRþPR) in FLT3-ITD-negative patients is substantially lower (41%, 17/41). As AC220 is a tyrosine kinase inhibitor, we hypothesized that investigating phosphorylation-based signaling on a system-wide scale in AML cells allows for identification of markers enabling more accurate prediction of therapy response as compared to commonly used genetic markers. Hence, we applied quantitative mass spectrometry to decipher a multivariate phosphorylation site marker, which we refer to as phosphosignature, in patient-derived AML blasts that might be useful as predictive biomarkers for AC220 treatment.
2017-05-10 | PXD006475 | Pride
Project description:Internal tandem duplications (ITD) in the receptor tyrosine kinase FLT3 occur in 25% of acute myeloid leukemia (AML) patients and lead to constitutive activation of FLT3, driving leukemia cell survival and proliferation. Quizartinib, crenolanib and gilteritinib are second-generation FLT3 inhibitors (FLT3i) in phase III trials or clinical use for the targeted treatment of FLT3-ITD+ AML. However, they demonstrated only limited benefit and were not curative. A full understanding of cellular resistance factors contributing to this poor response is lacking. Here, we examined cell-autonomous pathways modulated by FLT3i using global translatome and phosphoproteome proteomics to identify non-genetic resistance mechanisms.
2022-08-25 | PXD023123 | Pride
Project description:Internal tandem duplications (ITD) in the receptor tyrosine kinase FLT3 occur in 25% of acute myeloid leukemia (AML) patients and lead to constitutive activation of FLT3, driving leukemia cell survival and proliferation. Quizartinib, crenolanib and gilteritinib are second-generation FLT3 inhibitors (FLT3i) in phase III trials or clinical use for the targeted treatment of FLT3-ITD+ AML. However, they demonstrated only limited benefit and were not curative. A full understanding of cellular resistance factors contributing to this poor response is lacking. Here, we examined cell-autonomous pathways modulated by FLT3i using global translatome and phosphoproteome proteomics to identify non-genetic resistance mechanisms.
2022-08-25 | PXD023125 | Pride