Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Integrative Genomic Analysis Reveals Widespread Enhancer Regulation by p53 in Response to DNA Damage

ABSTRACT: The tumor suppressor p53 has been studied extensively as a direct transcriptional activator of protein-coding genes. Recent studies, however, have shed light on novel regulatory functions of p53 within noncoding regions of the genome. Here, we use a systematic approach that integrates transcriptome-wide differential expression analysis, genome-wide p53 binding profiles, chromatin state maps, and additional genomic features to characterize the global regulatory roles of p53 in response to DNA damage in both human and mouse fibroblast models. In addition to known p53 targets, we identify many previously unappreciated mRNAs and long noncoding RNAs that are regulated by p53. Moreover, we find that p53 binding events occur predominantly within enhancer elements in both human and mouse systems. The ability to modulate enhancer activity offers an additional layer of complexity to the p53 network and greatly expands the diversity of genomic elements that are directly regulated by p53. Human and Mouse fibroblasts cultured in the presence or absence of doxorubicin followed by RNA-Seq (Human:2 cell lines, each condition in duplicate; Mouse:MEF cell line,each condition in triplicate) and p53 ChIP-Seq (Human:2 cell lines, input and IP for each; Mouse:MEF cell line, input and IP)

ORGANISM(S): Homo sapiens

SUBMITTER: Scott Younger

PROVIDER: E-GEOD-55727 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

Integrative genomic analysis reveals widespread enhancer regulation by p53 in response to DNA damage.

Younger Scott T ST Kenzelmann-Broz Daniela D Jung Heiyoun H Attardi Laura D LD Rinn John L JL

Nucleic acids research 20150416 9

The tumor suppressor p53 has been studied extensively as a direct transcriptional activator of protein-coding genes. Recent studies, however, have shed light on novel regulatory functions of p53 within noncoding regions of the genome. Here, we use a systematic approach that integrates transcriptome-wide expression analysis, genome-wide p53 binding profiles and chromatin state maps to characterize the global regulatory roles of p53 in response to DNA damage. Notably, our approach identified conse ...[more]

PMID: 25883152

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Integrative Genomic Analysis Reveals Widespread Enhancer Regulation by p53 in Response to DNA Damage

Publications

Integrative genomic analysis reveals widespread enhancer regulation by p53 in response to DNA damage.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets