Genome-wide map of long non-coding RNA steroid receptor RNA activator (SRA) and its associated RNA heliase p68 in human pluripotent stem cells NTERA2
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Gary Felsenfeld
PROVIDER: E-GEOD-58641 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We performed Chromatin Isolation by RNA Purification (ChIRP) of SRA and ChIP of p68 following by high-throughput sequencing in NTERA2 cell line. We find that SRA localizes with p68 genome-wide at genes whose function is involved in embryonic development.
2014-06-18 | GSE58641 | GEO
Project description:CCCTC-binding factor (CTCF) is a DNA-binding protein that plays important roles in chromatin organization, though the mechanism by which CTCF carries out these functions is not fully understood. Recent studies show that CTCF recruits the cohesin complex to insulator sites and that cohesin is required for insulator activity. Here we have shown that the DEAD box RNA helicase p68 (DDX5) and its associated noncoding RNA, steroid receptor RNA activator (SRA), form a complex with CTCF that is essential for insulator function. p68 was detected at CTCF sites in the IGF2/H19 imprinted control region (ICR) as well as other genomic CTCF sites. In vivo depletion of SRA or p68 reduced CTCF-mediated insulator activity at the IGF2/H19 ICR, increased levels of IGF2 expression, and increased interactions between the endodermal enhancer and IGF2 promoter. p68/SRA also interacts with members of the cohesin complex. Depletion of either p68 or SRA does not affect CTCF binding to its genomic sites, but it does reduce cohesin binding. The results suggest that p68/SRA stabilizes the interaction of cohesin with CTCF, by binding to both, and is required for proper insulator function.
2010-11-16 | GSE24126 | GEO
Project description:CCCTC-binding factor (CTCF) is a DNA-binding protein that plays important roles in chromatin organization, though the mechanism by which CTCF carries out these functions is not fully understood. Recent studies show that CTCF recruits the cohesin complex to insulator sites and that cohesin is required for insulator activity. Here we have shown that the DEAD box RNA helicase p68 (DDX5) and its associated noncoding RNA, steroid receptor RNA activator (SRA), form a complex with CTCF that is essential for insulator function. p68 was detected at CTCF sites in the IGF2/H19 imprinted control region (ICR) as well as other genomic CTCF sites. In vivo depletion of SRA or p68 reduced CTCF-mediated insulator activity at the IGF2/H19 ICR, increased levels of IGF2 expression, and increased interactions between the endodermal enhancer and IGF2 promoter. p68/SRA also interacts with members of the cohesin complex. Depletion of either p68 or SRA does not affect CTCF binding to its genomic sites, but it does reduce cohesin binding. The results suggest that p68/SRA stabilizes the interaction of cohesin with CTCF, by binding to both, and is required for proper insulator function. Identification of p68-binding sites in Hela cells using ChIP-Seq.
2010-11-16 | E-GEOD-24126 | biostudies-arrayexpress
Project description:We performed Chromatin Isolation by RNA Purification (ChIRP) of SRA by high-throughput sequencing in K562 cell line. We find that SRA occupied genome-wide including alpha- and beta-globin loci.
2020-07-04 | GSE153004 | GEO
Project description:Identification of cell-type specific enhancers is important for understanding the regulation of programs controlling cellular development and differentiation. Enhancers are typically marked by the co-transcriptional activator protein p300 or by groups of cell-expressed transcription factors. We hypothesized that a unique set of enhancers regulates gene expression in human erythroid cells, a highly specialized cell type evolved to provide adequate amounts of oxygen throughout the body. Using chromatin immunoprecipitation followed by massively parallel sequencing, genome-wide maps of candidate enhancers were constructed for p300 and four transcription factors, GATA1, NF-E2, KLF1, and SCL, using primary human erythroid cells. These data were combined with gene expression analyses and candidate enhancers identified. Consistent with their predicted function as candidate enhancers, there was statistically significant enrichment of p300 and combinations of co-localizing erythroid transcription factors within 1-50 kb of the TSS of genes highly expressed in erythroid cells. Candidate enhancers were also enriched near genes with known erythroid cell function or erythroid cell phenotypes. Candidate enhancers exhibited only moderate conservation with mouse and minimal conservation with nonplacental vertebrates. Candidate enhancers were mapped to a data set of erythroid-associated, biologically relevant, SNPs from the GWAS catalog of the NHGRI. Fourteen candidate enhancers, representing 10 genetic loci, mapped to sites associated with biologically relevant erythroid traits. Fragments from these loci directed statistically significant expression in reporter gene assays. Identification of enhancers in human erythroid cells will allow a better understanding of erythroid cell development, differentiation, structure, and function, and provide insights into inherited and acquired hematologic disease. CD34+-selected stem and progenitor cells were expanded for three days in the absence of EPO. The cells were further cultured in the presence of EPO, and formaldehyde crosslinked chromatin was isolated after cells differentiated into R3/R4 nucleated erythroid cells. Chromatin Immunoprecipitation followed by sequencing (chIP-seq) was performed using antibodies against GATA1, KLF1, NFE2, TAL1, p300, H3K4me2 and H3K4me3, along with a total input control. Raw data (fastq, SRA) is missing for the TAL1 chIP-seq dataset
2013-01-28 | E-GEOD-43625 | biostudies-arrayexpress
Project description:The T-cell leukemia homeobox 1 (TLX1, HOX11) transcription factor is critically involved in the multistep pathogenesis of T-cell acute lymphoblastic leukemia (T-ALL) and often cooperates with NOTCH1 activation during malignant T-cell transformation. However, the exact molecular mechanisms by which these T-cell specific oncogenes cooperate during transformation remain to be established. Here, we used an integrative genomics approach to show that the oncogenic properties of TLX1 are mediated by genome-wide interference with the ETS1 and RUNX1 transcription factors. Partial disruption of ETS1 and RUNX1 activity by ectopic TLX1 expression in immature thymocytes drives repression of T-cell specific super-enhancers and mediates an unexpected transcriptional antagonism with NOTCH1 signaling. These phenomena coordinately trigger a TLX1 driven pre-leukemic phenotype in human thymic precursor cells, which corresponds with the in vivo thymic regression observed in murine TLX1 tumor models, and creates a strong genetic pressure for acquiring activating NOTCH1 mutations as a prerequisite for full leukemic transformation. In conclusion, our results uncover a functional antagonism between cooperative oncogenes during the earliest phases of tumor development and provide novel insights in the multistep pathogenesis of TLX1 driven human leukemia. ChIP-sequencing data was generated for TLX1 in the T-ALL cell line ALL-SIL.
2015-08-05 | E-GEOD-62264 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:The investigation of the association of long non-coding RNAs (lncRNAs) with DNMT1 by RIP-seq reveals that DNMT1 interacts with DACOR1. We identified the genomic occupancy sites of DACOR1 through ChIRP-seq, which we found to significantly overlap with known differentially methylated regions (DMRs) in colon tumors. Induction of DACOR1 in colon cancer cell lines significantly reduced their ability to form colonies in vitro, suggesting a growth suppressor function. Consistent with the observed phenotype, induction of DACOR1 led to the activation of tumor-suppressor pathways and attenuation of cancer-associated metabolic pathways. Notably, DACOR1 induction resulted in down-regulation of Cystathionine ?-synthase (CBS), which is known to lead to increased levels of S-adenosyl methionine (SAM) – the key methyl donor for DNA methylation. The DNA methyltransferase DNMT1 was immunoprecipitated and all associated RNAs were identified by RNA-seq and subsequent bioinformatic analyses. Samples were prepared for DNA sequencing through the ChIRP-seq protocol which uses antisense DNA oligos to bind to DACOR1 and pull down associated DNA in complex. We sequenced one sample with DACOR1 specific probes and non-specific DNA probes as control. Three samples were collected for each control lentivirus transduced V852 colon cancer line and DACOR1 lentivirus transduced V852. Samples were processed for RNA-sequencing and analyzed through differential expression analysis.
2015-09-15 | E-GEOD-58989 | biostudies-arrayexpress
Project description:The RING domain protein Arkadia/RNF111 is a ubiquitin ligase in the transforming growth factor beta (TGFβ) pathway. We previously identified Arkadia as a small ubiquitin-like modifier (SUMO)-binding protein with clustered SUMO-interacting motifs (SIMs) that together form a SUMO-binding domain (SBD). However, precisely how SUMO interaction contributes to the function of Arkadia was not resolved. Through analytical molecular and cell biology, we found that the SIMs share redundant function with Arkadia's M domain, a region distinguishing Arkadia from its paralogs ARKL1/ARKL2 and the prototypical SUMO-targeted ubiquitin ligase (STUbL) RNF4. The SIMs and M domain together promote both Arkadia's colocalization with CBX4/Pc2, a component of Polycomb bodies, and the activation of a TGFbeta pathway transcription reporter. Transcriptome profiling through RNA sequencing showed that Arkadia can both promote and inhibit gene expression, indicating that Arkadia's activity in transcriptional control may depend on the epigenetic context, defined by Polycomb repressive complexes and DNA methylation [Sun, Liu, and Hunter (2014) Mol Cell Biol 34(16):2981-2995]. To determine the role of Arkadia in TGFβ signaling at the transcriptome level, the profiles of TGFβ-stimulated gene expression were examined in Ark+/+ (Ark_WT), Ark-/- (Ark_null), and Arkadia (WT and sim mutant)-reconstituted Ark-/- MEFs. RNA sequencing was carried out using poly(A)-enriched RNA samples from unstimulated cells and cells treated with TGFβ for 1h, 4h, or 16h as indicated. Two batches of sequencing data for a total of 16 independent samples were submitted.
2015-02-11 | E-GEOD-65796 | biostudies-arrayexpress
Project description:Chromatin accessibility captures the binding status of protein factors to chromosomes in vivo, and has been considered a highly informative proxy for functional protein-DNA interactions. Existing DNase I and Tn5 transposase based assays generally require tens of thousands to millions of fresh cells. Applying Tn5 tagmentation to single cells yields very sparse maps. Here we present a transposome hypersensitive sites sequencing assay (THS-seq) for highly sensitive characterizations of chromatin accessibility. Validation of THS-seq method, and comparison of DNase-seq, ATAC-seq and THS-seq methods for quantitation of chromatin accessibility. GSE47753, GSM1155957 GM12878_ATACseq_50k_Rep1, data downsampled to 8,351,125 reads for analysis: pub_SRR891268_ATAC-seq_50k_cells_Rep1_downsampled_dfilter_peaks.bed.gz GSE47753, GSM1155958 GM12878_ATACseq_50k_Rep2, data downsampled to 8,351,125 reads for analysis: pub_SRR891269_ATAC-seq_50k_cells_Rep2_downsampled_dfilter_peaks.bed.gz GSE47753, GSM1155959 GM12878_ATACseq_50k_Rep3, data downsampled to 8,351,125 reads for analysis: pub_SRR891270_ATAC-seq_50k_cells_Rep3_downsampled_dfilter_peaks.bed.gz GSE47753, GSM1155960 GM12878_ATACseq_50k_Rep4, data downsampled to 8,351,125 reads for analysis: pub_SRR891271_ATAC-seq_50k_cells_Rep4_downsampled_dfilter_peaks.bed.gz GSE47753, GSM1155961 GM12878_ATACseq_500_Rep1, data downsampled to 8,351,125 reads for analysis: pub_SRR891272_ATAC-seq_500_cells_Rep1_downsampled_dfilter_peaks.bed.gz GSE47753, GSM1155962 GM12878_ATACseq_500_Rep2, data downsampled to 8,351,125 reads for analysis: pub_SRR891273_ATAC-seq_500_cells_Rep2_downsampled_dfilter_peaks.bed.gz raw data files were merged, alignment with bowtie 1.3 using parameters, bowtie -n1 -k1 --best --chunkmbs 10240 --strata -l32 -m1 -p4 --nomaqround --sam, followed by clonal read removal for the final data file for further analysis. GSM816665, raw data obtained from UCSC genome browser, https://genome.ucsc.edu/cgi-bin/hgFileUi?db=hg19&g=wgEncodeOpenChromDnase: wgEncodeOpenChromDnaseGm12878RawData_merged_unique_dfilter_peaks.bed.gz raw data files were merged, alignment with bowtie 1.3 using parameters, bowtie -n1 -k1 --best --chunkmbs 10240 --strata -l32 -m1 -p4 --nomaqround --sam, followed by clonal read removal for the final data file for further analysis. GSM864360, raw data obtained from UCSC genome browser, https://genome.ucsc.edu/cgi-bin/hgFileUi?db=hg19&g=wgEncodeOpenChromFaire: wgEncodeOpenChromFaireGm12878RawData_merged_unique_dfilter_peaks.bed.gz raw data files were merged, alignment with bowtie 1.3 using parameters, bowtie -n1 -k1 --best --chunkmbs 10240 --strata -l32 -m1 -p4 --nomaqround --sam, followed by clonal read removal for the final data file for further analysis. GSM736496, GSM736620, raw data obtained from UCSC genome browser, https://genome.ucsc.edu/cgi-bin/hgFileUi?db=hg19&g=wgEncodeUwDnase: wgEncodeUwDnaseGm12878RawData_merged_unique_dfilter_peaks.bed.gz
2016-01-09 | E-GEOD-72089 | biostudies-arrayexpress