Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

54 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Quantitative modeling of transcription factor binding specificities using DNA shape

ABSTRACT: The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

ORGANISM(S): Homo sapiens

SUBMITTER: Namiko Abe

PROVIDER: E-GEOD-60200 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-M-NM-:B as an example

Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress

Deconvolving the recognition of DNA shape from sequence

Project description:Binding of transcription factors to DNA is mediated by the recognition of the chemical signatures of the DNA bases and the three-dimensional shape of the DNA molecule. The direct contribution of DNA shape to DNA-binding specificity has been difficult to assess, as DNA shape is a consequence of its sequence. Here, we teased apart these two modes of recognition in the context of Hox-DNA binding. We made a series of mutations in Hox residues that, in a co-crystal structure, only recognize DNA shape, and tested the effect on DNA binding preferences using SELEX-seq. Analysis of shape features of selected sequences revealed that these residues are both necessary and sufficient for selection of sequences with distinct shape features. We used statistical machine learning to show that the accuracy of binding specificity predictions improves by adding shape features to a model that only depends on sequence. We conclude that shape readout is a direct and critical component of binding site selection by Hox proteins. Three rounds of SELEX were performed on a series of Hox mutants as described in Slattery et al, Cell, 2011 (PMID 22153072) and Riley et al, Methods in molecular Biology, 2014 (PMID 25151169). Briefly, His-tagged Scr and Antp mutant proteins were incubated with a randomized 16mer oligonucleotide library, and bound DNA was amplified and sequenced as described (PMID 22153072, PMID 25151169).

2015-01-21 | E-GEOD-65073 | biostudies-arrayexpress

Extensive characterization of NF-kappaB binding uncovers non-canonical motifs and advances the interpretation of genetic functional traits

Project description:We report the DNA binding preferences of 4 NF-kappaB dimers (p52p52, RELARELA, RELAp50, RELAp52) Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2011-05-24 | E-GEOD-29460 | biostudies-arrayexpress

HT-SELEX of wild-type and mutated versions of recombinant DNA binding domain of SALL4

Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.

2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment. We re-sequenced the libraries from E-MTAB-9236 with very high coverage to estimate the minimum number of reads required per sample for accurate results.

2022-03-01 | E-MTAB-11484 | biostudies-arrayexpress

The SET-domain protein SUVR5 mediates H3K9me2 deposition and silencing at stimulus response genes in a DNA methylation independent manner [SELEX]

Project description:In eukaryotic cells, environmental and developmental signals alter chromatin structure and modulate gene expression. Heterochromatin constitutes the transcriptionally inactive state of the genome and in plants and mammals is generally characterized by DNA methylation and histone modifications such as histone H3 lysine 9 (H3K9) methylation. In Arabidopsis thaliana DNA methylation and H3K9 methylation are usually colocated and set up a mutually self reinforcing and stable state. Here, in contrast, we found that SUVR5, a plant Su(var)3-9 homolog with a SET histone methyltransferase domain, mediates H3K9me2 deposition and regulates gene expression in a DNA-methylation-independent manner. SUVR5 binds DNA through its zinc fingers and represses the expression of a subset of stimulus response genes. This represents a novel mechanism for plants to regulate their chromatin and transcriptional state, which may allow for the adaptability and modulation necessary to rapidly respond to extracellular cues. one experiment and one control.

2014-06-06 | E-GEOD-58034 | biostudies-arrayexpress

Overlapping and distinct functions of CstF64 and CstF64τ in mammalian mRNA 3’ processing

Project description:Our study of CstF64 and CstF64τ revealed both functional overlap and specificity of these two important mRNA 3’ processing factors and provided new insights into the regulatory mechanisms of mRNA 3’ processing. CstF64tau iCLIP-seq in HeLa cells; direct RNA sequencing (DRS) of control HeLa cells, CstF64tau-RNAi cells and SELEX-seq for RNA control pool, CstF64 and CstF64tau.

2013-09-30 | E-GEOD-51156 | biostudies-arrayexpress

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM)

2015-03-01 | GSE60200 | GEO

Roles of Cofactors and Chromatin Accessibility in Hox Protein Target Specificity

Project description:Regulation of specific target genes by transcription factors is central to gene network control in development. How target specificity is achieved in eukaryotic genomes is poorly understood, as exemplified by the Hox family, which show limited in vitro DNA-binding specificity but clear functional specificity in vivo. We generated genome-wide binding profiles for three Hox proteins, Ubx, Abd-A and Abd-B, in Drosophila Kc167 cells, revealing clear target specificity and a striking influence of chromatin accessibility. Ubx and Abd-A bind to similar target sites in accessible chromatin whereas Abd-B binds additional specific targets. Provision of the TALE class cofactors, Exd and Hth, alters the Ubx binding profile, enabling binding to additional targets in the genome. Both the Abd-B specific targets and the cofactor-dependent Ubx targets are in relatively DNase1 inaccessible chromatin, suggesting that competition with nucleosomes is a key factor determining Hox protein target specificity. This ChIP-Seq study performed on Kc167 cells involves two experiments and 6 ChIP samples. In Experiment 1, we generated genome-wide binding profiles for Ubx, Abd-A and Abd-B. An equal volume of input chromatin was retained from each of the Hox samples and combined to represent the input, which was purified alongside the ChIP samples. We performed two biological replicates for each sample. Sequencing was performed using the Illumina MiSeq platform. In Experiment 2, we generated genome-wide binding profiles for Ubx, mutant Ubx and Ubx in the presence of Hth. We performed two biological replicates for each sample except Ubx where we performed just one. Sequencing was performed using the Illumina HiSeq 2000 platform. For all samples, Experiment 1 input chromatin was used as the reference control to assay ChIP enrichment.

2015-12-07 | E-GEOD-69796 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data