Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

55 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

ABSTRACT: To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment. We re-sequenced the libraries from E-MTAB-9236 with very high coverage to estimate the minimum number of reads required per sample for accurate results.

INSTRUMENT(S): NextSeq 500

ORGANISM(S): synthetic construct

SUBMITTER: Adrian Bird

PROVIDER: E-MTAB-11484 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

HT-SELEX of wild-type and mutated versions of recombinant DNA binding domain of SALL4

Project description:To investigate the differences in DNA binding specificity of wild-type SALL4 C2H2 zinc finger cluster 4 (ZFC4) and disease causing mutations in SALL4 ZFC4, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified wild-type SALL4 ZFC4 domain, mutated SALL4 ZFC4 (R900W) and mutated SALL4 ZFC4 (G921D) combined with no protein control experiment.

2023-01-04 | E-MTAB-11519 | biostudies-arrayexpress

HT-SELEX of recombinant C2H2 zinc finger domains of Sall4

Project description:To define the sequence preference of SALL4 C2H2 zinc finger domains, we performed SELEX coupled with high-throughput sequencing (HT-SELEX) using the purified SALL4 ZFC1, ZFC2 and ZFC4 domains combined with no protein control experiment.

2021-01-05 | E-MTAB-9236 | biostudies-arrayexpress

ChIP-Seq of ES-E14 mouse embryonic stem cells investigating changes in Sall4

Project description:Sall4 is a stem cell factor which is important for embryogenesis. We have genetically modified Sall4 in mouse embryonic stem cells to access the preference of Sall4 binding site. There are three different genetic modifications for the ES cells in the form of Sall4 Knockout (KO), Sall4 Zinc Finger Cluster 4 Mutation (ZFC4mut) and Sall4 Zinc Finger Cluster 1-2 Deletion (ZFC1-2Δ) respectively that we have considered for our study.

2021-01-05 | E-MTAB-9197 | biostudies-arrayexpress

An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-M-NM-:B as an example

Project description:We provided an improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor. We valided the strategy by characterzing the DNA-binding specificty of NF-M-NM-:B p50 dimer. Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2014-05-05 | E-GEOD-48660 | biostudies-arrayexpress

Extensive characterization of NF-kappaB binding uncovers non-canonical motifs and advances the interpretation of genetic functional traits

Project description:We report the DNA binding preferences of 4 NF-kappaB dimers (p52p52, RELARELA, RELAp50, RELAp52) Proteins of the Nf-kappab family were bound to DNA oligonucleotides containing a degenerate region. The protein-DNA complexes were selected after one or multiple rounds of SELEX and the DNA molecules were deep sequenced.

2011-05-24 | E-GEOD-29460 | biostudies-arrayexpress

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

Timecourse RNA-seq of mouse embryonic stem cells during neural differentiation

Project description:Sall4 is a stem cell factor which is important for embryogenesis. We have genetically modified Sall4 in mouse embryonic stem cells to access the transcriptional changes. There are three different genetic modifications for the ES cells in the form of Sall4 Knockout (KO), Sall4 Zinc Finger Cluster 4 Mutation (ZFC4mut) and Sall4 Zinc Finger Cluster 1-2 Deletion (ZFC1-2Δ) respectively that we have considered for our study. Cells were subjected to neural differentiation and directly lysed on the plate at the appropriate timepoint and RNA was sequenced.

2021-01-05 | E-MTAB-9198 | biostudies-arrayexpress

Splicing enhances recruitment of methyltransferase HYPB/Setd2 and methylation of histone H3 lysine 36

Project description:Several lines of recent evidence support a role for chromatin in splicing regulation. Here we show that splicing can also contribute to histone modification, which implies a bidirectional communication between epigenetics and RNA processing. Genome-wide analysis of histone methylation in human cell lines and mouse primary T cells reveals that intron-containing genes are preferentially marked with H3K36me3 relative to intronless genes. In intron-containing genes, H3K36me3 marking is proportional to transcriptional activity, whereas in intronless genes H3K36me3 is always detected at much lower levels. Furthermore, splicing inhibition impairs recruitment of H3K36 methyltransferase HYPB/Setd2 and reduces H3K36me3, whereas splicing activation has the opposite effect. Moreover, the increase of H3K36me3 correlates with the length of the first intron, consistent with the view that splicing enhances H3 methylation. We propose that splicing is mechanistically coupled to recruitment of HYPB/Setd2 to elongating RNA Polymerase II. This experiment proposes to profile genome-wide binding profiles by ChIP-seq (Illumina, 36 bp tags) of RNA polymerase II (one biological replicate), the histone modification H3K36me3 (2 replicates) and a reference control input sample (genomic DNA after reverse cross-link, one replicate) in a human H1299 lung carcinoma cell line *** Raw data not provided for Samples GSM766322-GSM766324.

2011-07-25 | E-GEOD-30902 | biostudies-arrayexpress

RNA-Seq of mouse embryonic stem cells after knockout and re-introduction of Sall4a

Project description:Sall4 is a stem cell factor which is important for embryogenesis. In order to address transcriptional changes, we re-introduce Sall4 in homozygous Sall4 knockout (KO) mouse embryonic stem cells through random integration of Sall4 cDNA using a Piggybac vector which is Dox inducible. We also re-introduce EGFP in homozygous Sall4 knockout (KO) mouse embryonic stem cells and use it as a negative control.

2021-01-05 | E-MTAB-9202 | biostudies-arrayexpress

Identification of Endos interacting proteins in Drosophila embryos by immunoprecipitation and LC-MS-MS/MS analysis

Project description:The transition from oocyte to embryo requires translation of maternally provided transcripts that in Drosophila is activated by Pan Gu kinase to release a rapid succession of 13 mitotic cycles. Mitotic entry is promoted by several protein kinases that include Greatwall/Mastl, whose endosulfine substrates antagonize Protein Phosphatase 2A (PP2A), facilitating mitotic Cdk1/Cyclin B kinase activity. Here we show that hyperactive greatwallScant can not only be suppressed by mutants in its Endos substrate, but also by mutants in Pan Gu kinase subunits. Conversely, mutants in me31B or trailer hitch (tral), which encode a complex that represses hundreds of maternal mRNAs, enhance greatwallScant. Me31B and Tral proteins, known substrates of Pan Gu kinase, copurify with Endos. This echoes findings that budding yeast Dhh1, orthologue of Me31B, associates with Igo1/2, orthologues of Endos and substrates of the Rim15 orthologue of Greatwall. endos-derived mutant embryos show reduced Me31B and elevated transcripts for the mitotic activators Cyclin B, Polo and Twine/Cdc25. Together, our findings demonstrate a previously unappreciated conservation of the Greatwall-endosulfine pathway in regulating translational repressors and its interactions with the Pan Gu kinase pathway to regulate translation and/or stability of maternal mRNAs upon egg activation.

2024-08-09 | PXD036613 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data