Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

ABSTRACT: Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

ORGANISM(S): Mus musculus

SUBMITTER: Jane Skok

PROVIDER: E-GEOD-62969 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait") that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes. 4C-Seq experiments from Igh and Cd83 bait in activated B cells and Tcrb (Eb) bait in double negative T cells and immature B cells. RNA-Seq and ATAC-Seq experiments in DN and Immature B cells.

Dataset Information

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets