Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The superenhancer binding factor Med1 is broadly required for optimally expressing and hypermutating IgH genes as well as for terminating their expression through locus suicide recombination

ABSTRACT: Assembly, expression and maturation of the Immunoglobulin heavy (IgH) chain repertoire necessitates long-range 3D-interactions under regulation by the IgH locus Eµ and 3’ regulatory region (3’RR) super-enhancers. In progenitors, Eµ instrumentally supports VDJ recombination notably towards distal VH genes. In mature cells, the 3’RR first boosts the production of membrane-type IgH transcripts. It later attracts Activation-induced cytidine deaminase at three specific locations: VDJ genes undergoing somatic hypermutation (SHM), switch regions undergoing class switch recombination (CSR), and the 3’RR itself during locus suicide recombination (LSR). In plasma cells devoted to abundant Ig secretion, a late long-range effect is to promote high IgH transcription. The Mediator subunit Med1, which binds super-enhancers and has increased activity after phosphorylation by ERK, was previously attributed a role restricted to class-switched cells. We now show its broader impact on IgH expression, both by promoting recombination of distal VH genes in progenitors and by later supporting SHM. Med1-dependence also marks all long-range functions of the 3’RR, including not only intra- but also trans-chromosomal CSR, LSR, optimal BCR expression and the transcriptional boost featured by plasma cells. Altogether, Med1 appears as a major and specific actor of all the long-range tasks effected by the IgH locus super-enhancers beyond transcription.

ORGANISM(S): Mus musculus

PROVIDER: GSE136845 | GEO | 2022/10/20

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

The Chromatin Reader ZMYND8 Regulates Igh Enhancers to Promote Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3’ Igh super-enhancer, 3’ Regulatory Region (3’RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here we identify the chromatin reader ZMYND8 as an essential regulator of the 3’RR and CSR. In B cells, ZMYND8 binds promoters and super-enhancers, including the 3’RR, and controls its activity by modulating the enhancer transcriptional status. In its absence, there is increased 3’RR polymerase loading, and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3’RR. Thus ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3’ Igh super-enhancer.

2018-10-04 | GSE118794 | GEO

Deciphering the importance of the palindromic architecture of the immunoglobulin heavy chain 3â?? regulatory region.

Project description:The IgH 3â?? regulatory region (3â??RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3â??RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the center of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. Evolution maintained in mammals this unique palindromic arrangement suggesting that it is functionally significant. We report that deconstructing the palindromic IgH 3â??RR strongly impacts its function even when enhancers are preserved. CSR and IgH transcription appear poorly dependent from the 3â??RR architecture and are more or less preserved provided 3â??RR enhancers are present. By contrast, an â??architectural effectâ?? significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3â??RR does not simply pile up enhancer units but also optimally expose them into a functional architecture of crucial importance. RNAseq analysis of B-cell splenocytes with (S=stimulated) or without (R=resting) LPS activation from wt, delta2leftPAL, and deltaIRIS mice.

2016-02-08 | E-GEOD-76359 | biostudies-arrayexpress

Deciphering the importance of the palindromic architecture of the immunoglobulin heavy chain 3’ regulatory region.

Project description:The IgH 3’ regulatory region (3’RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3’RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the center of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. Evolution maintained in mammals this unique palindromic arrangement suggesting that it is functionally significant. We report that deconstructing the palindromic IgH 3’RR strongly impacts its function even when enhancers are preserved. CSR and IgH transcription appear poorly dependent from the 3’RR architecture and are more or less preserved provided 3’RR enhancers are present. By contrast, an “architectural effect” significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3’RR does not simply pile up enhancer units but also optimally expose them into a functional architecture of crucial importance.

2016-02-08 | GSE76359 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [Micro-C]

Project description:Antibody class switch recombination (CSR) requires the ligation of DNA breaks in transcribed and juxtaposed donor and acceptor switch (S) sequences (S-S synapsis) spaced 50-200 kb apart within the immunoglobulin heavy chain locus (Igh). CSR is believed to occur via the association of active S regions with the 3’ regulatory region (3’RR) super-enhancer thereby coupling transcription with S-S synapsis. Here, we map the multi-way interactome underlying CSR using Tri-C. Surprisingly, S-S synapsis is strongly associated with the 3` CTCF binding element (3`CBE), but not the 3’RR, a finding also confirmed by Micro-C measurements. Instead, the 3’RR forms a self-interacting domain independently engaging with Igh genes. Additionally, transcription at acceptor S regions creates a topological barrier that insulates S-S synapsis from loop extrusion complexes. Thus, Igh gene activation and S-S synapsis occur via distinct topological states created by the interaction between transcription and the loop extrusion machinery.

2023-01-20 | GSE198181 | GEO

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [PRO-seq]

2023-01-20 | GSE198180 | GEO

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [Tri-C]

2023-01-20 | GSE198179 | GEO

A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [ChIP-Seq]

2023-01-20 | GSE198176 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

2016-02-17 | GSE62969 | GEO

Immunoglobulin repertoires in mice carrying a knock-in human Cµ gene downstream of the IGH 3' regulatory region

Project description:To in-depth analyze the repertoire of B cells after the occurrence of recombination events joining SÙ to the IgH downstream regulatory region (3'RR)

2023-06-28 | GSE233503 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data