IRF4, a master transcription factor, regulates genes involved in BCR signaling, antigen processing and presentation, and GC development
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Yasuhiro Nakayama
PROVIDER: E-GEOD-64270 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).
2015-12-15 | E-GEOD-64268 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâs lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. BL2 Burkitt's lymphoma-derived B cells were infected with lentivirus expressing shRNA for IRF4 or control, and total RNA was subjected to Illumina BeadsExpression Arrays analysis.
2015-12-15 | E-GEOD-64269 | biostudies-arrayexpress
Project description:ChIP-seq was performed to map transcription factor (TF) binding in monocytes during in vitro differentiation. To map binding sites for TF lacking suitable antibodies we also performed mRNA transfections using synthetic mRNAs translating into 3xFLAG TF versions that were ChIPed using Anti-Flag antibody.
2021-02-03 | E-MTAB-9927 | biostudies-arrayexpress
Project description:The transcription factor Cst6p in Saccharomyces cerevisiae has been reported to play important roles in several biological processes. However, the genome-wide targets of Cst6p and the mechanisms for its physiological functions remain unknown. Here, we mapped the genome-wide binding sites of Cst6p with ChIP-exo at high resolution. Cst6p binds to the promoter regions of 59 genes with various biological functions when cells are grown on ethanol, but hardly binds to the genome on glucose. The growth deficiency of CST6 deletion mutant on ethanol is attributed to the markedly decreased expression of carbonic anhydrase gene NCE103, which is a direct target of Cst6p. The target genes of Cst6p have a large overlap with those of stress-responsive transcription factors, such as Sko1p and Skn7p. In addition, the CST6 deletion mutant growing on ethanol shows hypersensitivity to oxidative stress and ethanol stress, assigning Cst6p as a new member of the stress-responsive transcriptional regulatory network. These results show that genome-wide binding site mapping is able to provide new insights into the function of transcription factors, and highlight the highly connected and condition-dependent nature of the transcriptional regulatory network in S. cerevisiae. The binding sites of Cst6p when cells were grown in glucose or ethanol were measured in biological duplicates, so there are four samples in total.
2016-04-04 | E-GEOD-76154 | biostudies-arrayexpress
Project description:We have characterized the transcriptional program regulated by ETV5 at the invasive front of endometrial carcinomas, by comparing it with non-invasive areas of the same tumor samples. In total 12 samples; 6 superficial (non-invasive) tumor areas and the corresponding invasive tumor zones.
2014-11-05 | E-GEOD-57870 | biostudies-arrayexpress
Project description:The glucocorticoid receptor (GR) binds the human genome at >10,000 sites, but only regulates the expression of hundreds of genes. To determine the functional effect of each site, we measured the glucocorticoid (GC) responsive activity of nearly all GR binding sites (GBSs) captured using chromatin immunoprecipitation (ChIP) in A549 cells. 13% of GBSs assayed had GC-induced activity. The responsive sites were defined by direct GR binding via a GC response element (GRE) and exclusively increased reporter- gene expression. Meanwhile, most GBSs lacked GC-induced reporter activity. The non-responsive sites had epigenetic features of steady state enhancers and clustered around direct GBSs. Together, our data support a model in which clusters of GBSs observed with ChIP-seq reflect interactions between direct and tethered GBSs over tens of kilobases. We further show that those interactions can synergistically modulate the activity of direct GBSs, and may therefore play a major role in driving gene activation in response to GCs. Glucoroticoid receptor binding site chip-seq libraries were cloned into STARR-seq for massively parallel functioal analysis. The results were confirmed by ChIP-Exo performed on the GR in A549 cells treated with 100 nM dexamethasone for one hour. This dataset [6] contains the ChIP exo data from cells treated with 100 nM DEX.
2016-08-25 | E-GEOD-79429 | biostudies-arrayexpress
Project description:Protein post-translational modifications transmit signals in part by creating binding sites for effector molecules. This is especially true in epigenetic pathways where histone tails are heavily modified, resulting in the recruitment of molecules that can affect transcription. One such molecule, plant homeodomain finger protein 20 (PHF20), uses a Tudor domain to read dimethyl-lysine residues and is a known component of the MOF histone acetyltransferase protein complex, suggesting it plays a role in the crosstalk between lysine methylation and histone acetylation. We sought to investigate the biological role of PHF20 by generating a knockout mouse. Without PHF20, mice die shortly after birth and display a wide variety of phenotypes within the skeletal and hematopoietic systems. Mechanistically, PHF20 is not required for maintaining the global H4K16 acetylation levels, but instead works downstream in transcriptional regulation of MOF target genes. ChIP sequencing of H4K16ace ChIP DNA from PHF20 knockout and wild type cells using Illumina Solexa Genome Analyzer II single end sequencing protocol.
2012-02-27 | E-GEOD-29306 | biostudies-arrayexpress
Project description:NSD2 (also named MMSET and WHSC1) is a histone lysine methyltransferase that is implicated in diverse diseases and commonly overexpressed in multiple myeloma due to a recurrent t(4;14) chromosomal translocation. However, the precise catalytic activity of NSD2 is obscure, preventing progress in understanding how this enzyme influences chromatin biology and myeloma pathogenesis. Here we show that dimethylation of histone H3 at lysine 36 (H3K36me2) is the principal chromatin-regulatory activity of NSD2. Catalysis of H3K36me2 by NSD2 is sufficient for gene activation. In t(4;14)-positive myeloma cells, the normal genome-wide and gene-specific distribution of H3K36me2 is obliterated, creating a chromatin landscape that selects for a transcription profile favorable for myelomagenesis. Catalytically active NSD2 confers xenograft tumor formation and invasion capacity upon t(4;14)-negative cells and NSD2 promotes oncogenic transformation of primary cells in an H3K36me2-dependent manner. Together our findings establish H3K36me2 as the primary product generated by NSD2, and demonstrate that genomic disorganization of this canonical chromatin mark initiates oncogenic programming. ChIP sequencing of H3K36me2 ChIP DNA from KMS11 and TKO2 cells using Illumina Solexa Genome Analyzer II single end sequencing protocol. The experiment contains two biological replicates of H3K36me2 ChIP DNA and input materials from KMS11 and TKO2 cells.
2011-11-29 | E-GEOD-29146 | biostudies-arrayexpress
Project description:We demonstrate that transcription factor IRF4 is induced in a T cell receptor (TCR) affinity-dependent manner and functions as a dose-dependent regulator of the metabolic function of activated T cells. IRF4 regulates the expression of key molecules required for aerobic glycolysis of effector T cells, and is essential for clonal expansion and maintenance of effector function of antigen-specific CD8+ T cells. Examination of binding sites of transcription factor IRF4 in mouse CD8+ T cells.
2013-08-17 | E-GEOD-49930 | biostudies-arrayexpress
Project description:Binding profiles of cohesin in resting mature murine splenic B lymphocytes and at two stages after cell activation were elucidated by chromatin immunoprecipitation and deep sequencing. RAD21 binding profile in resting, 48h- and 96h-stimulated B cells were analyzed in three replicates and normalized to input DNA.
2014-10-02 | E-GEOD-61443 | biostudies-arrayexpress