Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

M6A level and isoform characterization sequencing (m6A-LAIC-seq) reveal the census and complexity of the m6A epitranscriptome

ABSTRACT: N6-methyladenosine (m6A) is a widespread reversible chemical modification of RNAs, implicated in many aspects of RNA metabolism. Little quantitative information exists as to either how many transcript copies of particular genes are m6A modified (âm6A levelsâ), or the relationship of m6A modification(s) to alternative RNA isoforms. To deconvolute the m6A epitranscriptome, we developed m6A level and isoform-characterization sequencing (m6A-LAIC-seq). We found that cells exhibit a broad range of non-stoichiometric m6A levels with cell type specificity. At the level of isoform characterization, we discovered widespread differences in use of tandem alternative polyadenylation (APA) sites by methylated and nonmethylated transcript isoforms of individual genes. Strikingly, there is a strong bias for methylated transcripts to be coupled with proximal APA sites, resulting in shortened 3â untranslated regions (3â-UTRs), while nonmethylated transcript isoforms tend to use distal APA sites. m6A-LAIC-seq yields a new perspective on transcriptome complexity and links APA usage to m6A modifications. m6A-LAIC-seq of H1-ESC and GM12878 cell lines, each cell line has two replicates

ORGANISM(S): Homo sapiens

SUBMITTER: Jinkai Wang

PROVIDER: E-GEOD-66086 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

m6A level and isoform characterization sequencing (m6A-LAIC-seq) reveal the census and complexity of the m6A epitranscriptome

Project description:N6-methyladenosine (m6A) is a widespread reversible chemical modification of RNAs, implicated in many aspects of RNA metabolism. Little quantitative information exists as to either how many transcript copies of particular genes are m6A modified (“m6A levels”), or the relationship of m6A modification(s) to alternative RNA isoforms. To deconvolute the m6A epitranscriptome, we developed m6A level and isoform-characterization sequencing (m6A-LAIC-seq). We found that cells exhibit a broad range of non-stoichiometric m6A levels with cell type specificity. At the level of isoform characterization, we discovered widespread differences in use of tandem alternative polyadenylation (APA) sites by methylated and nonmethylated transcript isoforms of individual genes. Strikingly, there is a strong bias for methylated transcripts to be coupled with proximal APA sites, resulting in shortened 3’ untranslated regions (3’-UTRs), while nonmethylated transcript isoforms tend to use distal APA sites. m6A-LAIC-seq yields a new perspective on transcriptome complexity and links APA usage to m6A modifications.

2016-06-24 | GSE66086 | GEO

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

The m6A reader CPSF30-L regulates alternative polyadenylation affecting nitrate signaling in Arabidopsis

Project description:As the most ubiquitous internal modification of eukaryotic mRNA, m6A (N6-methyladenosine) modification plays a vital role in almost every aspect of mRNA metabolism. However, the evidence of m6A in regulating the alternative polyadenylation (APA) is limited. APA is controlled by a large protein-RNA complex with many components including CPSF30. Arabidopsis CPSF30 has two isoforms, the longer one named CPSF30-L containing an additional YTH (YT512-B Homology)-domain in the C terminus, which is unique in plant. In this study, we revealed that m6A modification directly regulated APA, by proving the capability of Arabidopsis CPSF30-L YTH domain binding to m6A substrate by using in vitro assay and structural studies. We observed that extensive genes shifted their poly(A) sites in cpsf30-2 and found that numerous genes altered polyadenylation site (PAS) that correlated well with previously identified m6A peaks, indicating that genes carry m6A modification are prone to be regulated by APA. Moreover, we found that several important genes involved in nitrate metabolism are amongst those genes with APA site alteration in cpsf30-2.And we could rescue these APA and nitrate metabolism defects by introducing the wild-type CPSF30-L, but not by m6A-binding defective mutants (W259A, W310A or Y319A), which explained the nitrogen signaling defects of cpsf30-2 discovered previously. Taken together, our results demonstrated that m6A modification could directly regulate APA in Arabidopsis and revealed the function of m6A reader CPSF30-L in nitrate signaling by controlling APA regulation. This study will shed new lights on the roles of m6A modification during RNA 3’-end processing in plant development.

2021-03-16 | GSE145109 | GEO

Alternative cleavage and polyadenylation in spermatogenesis coordinates chromatin regulation and post-transcriptional control

Project description:Most mammalian genes display alternative cleavage and polyadenylation (APA). Previous studies have indicated preferential expression of APA isoforms with short 3âUTRs in testes. Here we show widespread shortening of 3âUTR by APA during the first wave of spermatogenesis in mouse, with 3âUTRs being the shortest in spermatids. Shortening of 3âUTR eliminates destabilizing elements, such as U-rich elements and transposable elements, which appear to be highly potent for transcript elimination during spermatogenesis. We additionally found widespread regulation of APA in introns and global activation of upstream antisense transcripts during spermatogenesis. Interestingly, genes that display 3âUTR shortening tend to have higher levels of H3K4me3, consistent with the open chromatin feature previously observed in spermatids. Since genes with 3âUTR shortening tend to have functions important for further sperm development after spermatids, when transcription is halted, this result indicates that expression of short, stable mRNAs may serve the purpose of mRNA storage for later translation. Thus, APA in spermatogenesis connects regulation of chromatin status with post-transcriptional control, and impacts sperm maturation. 3'READS of 1 week to 6 week of testis development

2016-01-11 | E-GEOD-73973 | biostudies-arrayexpress

m6A reader CPSF70 controls polyadenylation site choice through m6A-dependent recognition of FUE polyadenylation signal

Project description:We conduct herein a systematic study of mRNA recognition and consequent polyadenylation processing of the Arabidopsis mRNA by m6A reader protein CPSF70. Transcriptome-wide characterization of CPSF70-binding sites supporting the recognition m6A-methylated mRNA with CPSF70, and the results of which linked polyadenylation signals recognition. We then perform 3’end sequencing with A-seq2 to identify CPSF70-dependent APA process, showing that CPSF70 modulate m6A–dependent polyadenylation with FUE recognition.

2022-01-15 | GSE143720 | GEO

Alternative Polyadenylation by Sequential Activation of Distal and Proximal PolyA Sites

Project description:Analogous to alternative splicing, alternative polyadenylation (APA) has long been thought to result from competition between proximal and distal polyA sites. By Fractionation-seq, we unexpectedly identified several hundred APA genes where their distal polyA isoforms are retained in chromatin/nuclear matrix and proximal polyA isoforms released into the cytoplasm. Global metabolic PAS-seq and Nanopore long-read RNA-seq provided further evidence that the strong distal polyA sites are first processed and the resulting transcripts are anchored in chromatin/nuclear matrix for further processing at proximal polyA sites and removal of certain slowly spliced introns. By engineering an autocleavable ribozyme between the proximal and distal polyA sites, we demonstrated that the distal polyA isoform is indeed the precursor to the proximal polyA isoform. Therefore, unlike alternative splicing, APA sites are recognized independently, rather than competitively, and in many cases, in a sequential manner. This provides a versatile strategy to regulate gene expression in mammalian cells.

2021-11-26 | GSE165742 | GEO

Alternative cleavage and polyadenylation analysis in an isoform-resolved way by Second- and Third-Generation Sequencing technologies

Project description:Alternative cleavage and polyadenylation (APA) is emerging as an important mechanism of gene regulation in eukaryotes and plays important regulatory roles in human development and diseases. Despite the widespread application of Second Generation Sequencing (SGS) technology for polyadenylation site identification, matching each identified polyadenylation site within a gene to its derived isoform remains a major challenge. To achieve the isoform-resolved APA analysis, we developed a tool termed “IDP-APA” that constructs truly expressed isoforms and identifies polyadenylation sites by integrating the respective strengths of Third Generation Sequencing (TGS) long reads and SGS short reads. Compared to existing tools, IDP-APA demonstrated superior performance in both isoform reconstruction and polyadenylation site identification. Applications to human embryonic stem cells, breast cancer cells and brain tissue from a patient with Alzheimer’s disease revealed prevalent APA events and cell-/tissue-specific APA patterns, especially in an isoform-resolved way.

2017-06-01 | GSE97688 | GEO

Transcriptome-wide high-throughput deep m6A-seq reveals unique m6A methylation differential patterns among three organs in Arabidopsis

Project description:m6A is a ubiquitous RNA modification in eukaryotes. Transcriptome-wide m6A patterns in Arabidopsis have been assayed recently. However, m6A differential patterns among organs have not been well characterized. The goal of the study is to comprehensively analyze m6A patterns of numerous types of RNAs, the relationship between transcript level and m6A methylation extent, and m6A differential patterns among organs in Arabidopsis. In total, 18 libraries were sequneced. For the 3 organs: leaf, flower and root, each organ has mRNA-Seq, m6A-Seq and Input sequenced. And each sequence has 2 replicats.

2015-10-28 | E-GEOD-72706 | biostudies-arrayexpress

3âREADS+, a sensitive and accurate method for 3â end sequencing of polyadenylated RNA

Project description:Sequencing of the 3â end of poly(A)+ RNA identifies cleavage and polyadenylation sites (pAs) and measures transcript expression. We previously developed a method, 3â region extraction and deep sequencing (3âREADS), to address mispriming issues that often plague 3â end sequencing. Here we report a new version, named 3âREADS+, which has vastly improved accuracy and sensitivity. Using a special locked nucleic acid oligo to capture poly(A)+ RNA and to remove bulk of the poly(A) tail, 3âREADS+ generates RNA fragments with an optimal number of terminal As that balance data quality and detection of genuine pAs. With improved RNA ligation steps for efficiency, the method shows much higher sensitivity (over two orders of magnitude) compared to the previous version. Using 3âREADS+, we have uncovered a sizable fraction of previously overlooked pAs located next to or within a stretch of adenylate residues in human genes, and more accurately assessed the frequency of alternative cleavage and polyadenylation (APA) in HeLa cells (~50%). 3âREADS+ will be a useful tool to accurately study APA and to analyze gene expression by 3â end counting, especially when the amount of input total RNA is limited. Nine 3'READS+ libraries were made with different amounts (100 ng, 200 ng, 400 ng, 1000 ng, 5000 ng, 15000 ng) of input Hela RNA.

2016-08-14 | E-GEOD-84170 | biostudies-arrayexpress

m6A mapping in human RNA (untreated)

Project description:We developed a novel approach, m6A-seq, for high-resolution mapping of the transcriptome-wide m6A landscape, based on antibody-mediated capture followed by massively parallel sequencing. Identification of m6A modified sequences in HepG2 cells.

2012-04-25 | E-GEOD-37003 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data