Transcription profiling of rat astrocytes cultured on the beta-amyloid peptide 25-35 fragment for 12 hours, 1, 3 and 5 days
Ontology highlight
ABSTRACT:
ORGANISM(S): Rattus norvegicus
SUBMITTER: William Clayton Spencer
PROVIDER: E-GEOD-856 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Cortical type-I astrocytes were cultured on the beta-amyloid peptide 25-35 fragment for 12hr, 1d, 3d, and 5d. Keywords = amyloid astrocytes rat Keywords: time-course
2003-12-09 | GSE856 | GEO
Project description:12hr, 1d, 3d, and 5d exposure of beta-amyloid to astrocytes
| PRJNA87869 | ENA
Project description:Background and purposeCilostazol may be effective in dementia associated with a cerebral ischaemia. In this study, we examined whether it exerts beneficial effects on learning and/or memory impairment induced by A?(25-35) in mice, and compared its effects with those of aspirin.Experimental approachA?(25-35) (9?nmol) was administered to mice i.c.v. Learning and memory behaviour were evaluated by measuring spontaneous alternation in a Y-maze and a step-down type passive avoidance test, on the 5th and 8th days after injection respectively. Levels of lipid peroxidation (malondialdehyde) and cytokines in the frontal cortex and hippocampus were measured 2, 3, 5 and 7 days after the A?(25-35) injection. The effects of repeated administration of cilostazol and aspirin (both at 30 and 100?mg·kg(-1), p.o.) on any changes induced by A?(25-35) were evaluated.Key resultsRepeated administration of cilostazol significantly attenuated the impairment of spontaneous alternation and the shortened step-down latency induced by A?(25-35) . Aspirin did not show any beneficial effect. A significant increase in the levels of malondialdehyde (MDA) and IL-1? (only measured in hippocampus) was observed 2, 3 and 5 days after the A?(25-35) injection in the frontal cortex and hippocampus. Repeated administration of cilostazol (100?mg·kg(-1)) completely prevented the increase in MDA levels but failed to antagonize the increase in the expression of IL-1? induced by A?(25-35).Conclusions and implicationsThese results suggest that the protective effect of cilostazol on A?(25-35)-induced memory impairment may be related to oxidative stress in the frontal cortex and the hippocampus.
| S-EPMC3010591 | biostudies-literature
Project description:The free energy landscape for folding of the Alzheimer's amyloid-beta(25-35) peptide is explored using replica exchange molecular dynamics in both pure water and in HFIP/water cosolvent. This amphiphilic peptide is a natural by-product of the Alzheimer's amyloid-beta(1-40) peptide and retains the toxicity of its full-length counterpart as well as the ability to aggregate into beta-sheet-rich fibrils. Our simulations reveal that the peptide preferentially populates a helical structure in apolar organic solvent, while in pure water, the peptide adopts collapsed coil conformations and to a lesser extent beta-hairpin conformations. The beta-hairpin is characterized by a type II' beta-turn involving residues G29 and A30 and two short beta-strands involving residues N27, K28, I31, and I32. The hairpin is stabilized by backbone hydrogen-bonding interactions between residues K28 and I31; S26 and G33; and by side-chain-to-side-chain interactions between N27 and I32. Implications regarding the mechanism of aggregation of this peptide into fibrils and the role of the environment in modulating secondary structure are discussed.
| S-EPMC1544315 | biostudies-literature
Project description:The amyloid-beta peptide (Aβ) is considered a key factor in Alzheimer's disease (AD) ever since the discovery of the disease. The understanding of its damaging influence has however shifted recently from large fibrils observed in the inter-cellular environment to the small oligomers interacting with a cell membrane. We studied the effect of temperature on the latter interactions by evaluating the structural characteristics of zwitterionic phosphatidylcholine (PC) membranes with incorporated Aβ25-35 peptide. By means of small angle neutron scattering (SANS), we have observed for the first time a spontaneous reformation of extruded unilamellar vesicles (EULVs) to discoidal bicelle-like structures (BLSs) and small unilamellar vesicles (SULVs). These changes in the membrane self-organization happen during the thermodynamic phase transitions of lipids and only in the presence of the peptide. We interpret the dramatic changes in the membrane's overall shape with parallel changes in its thickness as the Aβ25-35 triggered membrane damage and a consequent reorganization of its structure. The suggested process is consistent with an action of separate peptides or small size peptide oligomers rather than the result of large Aβ fibrils.
| S-EPMC8578324 | biostudies-literature
Project description:Amyloid β protein (Aβ) is closely related to the progression of Alzheimer's disease because senile plaques consisting of Aβ cause synaptic depression and synaptic abnormalities. In the central nervous system, astrocytes are a major glial cell type that contribute to the modulation of synaptic transmission and synaptogenesis. In this study, we examined whether astrocytes exposed to Aβ fragment 25-35 (Aβ25-35) affect synaptic transmission. We show that synaptic transmission by hippocampal neurons was inhibited by astrocytes exposed to Aβ25-35. The Aβ25-35-exposed astrocytes lowered excitatory postsynaptic release and the size of the readily releasable synaptic pool. The number of excitatory synapses was also reduced. However, the number of excitatory synapses was unchanged unless there was direct contact between Aβ25-35-exposed astrocytes and hippocampal neurons. These data indicate that direct contact between Aβ25-35-exposed astrocytes and neurons is critical for inhibiting synaptic transmission in the progression of Alzheimer's disease.
| S-EPMC6669318 | biostudies-literature
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:The amyloid-?(25-35) peptide plays a key role in the etiology of Alzheimer's disease due to its extreme toxicity even in the absence of aging. Because of its high tendency to aggregate and its low solubility in water, the structure of this peptide is still unknown. In this work, we sought to understand the early stages of aggregation of the amyloid-?(25-35) peptide by conducting simulations of oligomers ranging from monomers to tetramers. Our simulations show that although the monomer preferentially adopts a ?-hairpin conformation, larger aggregates have extended structures, and a clear transition from compact ?-hairpin conformations to extended ?-strand structures occurs between dimers and trimers. Even though ?-hairpins are not present in the final architecture of the fibril, our simulations indicate that they play a critical role in fibril growth. Our simulations also show that ?-sheet structures are stabilized when a ?-hairpin is present at the edge of the sheet. The binding of the hairpin to the sheet leads to a subsequent destabilization of the hairpin, with part of the hairpin backbone dangling in solution. This free section of the peptide can then recruit an extra monomer from solution, leading to further sheet extension. Our simulations indicate that the peptide must possess sufficient conformational flexibility to switch between a hairpin and an extended conformation in order for ?-sheet extension to occur, and offer a rationalization for the experimental observation that overstabilizing a hairpin conformation in the monomeric state (for example, through chemical cross-linking) significantly hampers the fibrillization process.
| S-EPMC3414875 | biostudies-other
Project description:The interactions of the Alzheimer's β-amyloid peptide, Aβ(25-35), with 18:1 (Δ9-Cis) PC 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), L-α-phosphatidylcholine (EPC), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium salt) (DOPG), and L-α-phosphatidylglycerol (EPG) phospholipid vesicles with and without cholesterol (Ch) are studied by the nitroxide spin probe electron paramagnetic resonance (EPR) method. Two nitroxide spin probes, 2,2,6,6-tetramethyl-piperidin-1-oxyl-4-yl hexadecanoate (TP, TEMPO-Palmitate) and 2-Ethyl-2-(15-methoxy-15-oxopentadecyl)-4,4-dimethyl-3-oxazolidinyloxy (16-DSE), are utilized in the study. TEMPO-Palmitate has the reporting EPR moiety located at the top of this spin probe, while 16-DSE has the reporting EPR moiety located at the tail of the spin probe. These two probes enable us to sample the surface and the middle of the phospholipid bilayer, respectively. All EPR measurements are done above the melting points of all four phospholipids when the bilayer is in the liquid crystal phase, the physiologically relevant phase. Due to non-linear spectral line fitting, the EPR spectral parameters are extracted with high precision. The results show that there are two populations of Aβ(25-35) and that one of them is located in the hydrophobic phospholipid layer below the hydrophilic headgroup region. The second population appears to be weakly coupled to the surface of the bilayer. Both hydrophobic and electrostatic interactions affect the insertion of Aβ(25-35) in the bilayer. Also, there is strong evidence for an interaction between cholesterol and Aβ(25-35), which affects the dielectric and dynamic properties of the bilayer.
| S-EPMC6342288 | biostudies-literature
Project description:In this study, experiments on amyloid β peptide25-35-induced mice were performed to provide in vivo evidence on the potential of the blood-brain barrier transportable soy dipeptide, Tyr-Pro, in combating memory impairment. We demonstrated for the first time that oral administration of Tyr-Pro (100 mg/kg, twice a day) in mice for 16 days significantly improved impaired memory by spontaneous alternation and shortened step-through latency in amyloid β-induced mice.
| S-EPMC7195433 | biostudies-literature