Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SsDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

ABSTRACT: We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

ORGANISM(S): Homo sapiens

PROVIDER: GSE124865 | GEO | 2019/09/30

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

| PRJNA514043 | ENA

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

2019-12-31 | GSE137006 | GEO

Potential capacity of aptamers to trigger immune activation in human blood

Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37Â°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics. To evaluate the influence of synthetic ssDNA oligonucleotides (SB_ODN, CpG_ODN) on the cells of circulating peripheral blood (n=3), the samples were divided into 7 groups, 0h_without ssDNA, 2h_without ssDNA, 2h_with SB_ODN, 2h_with CpG_ODN, 4h_without ssDNA, 4h_with SB_ODN, 4h_with CpG_ODN. Baseline value samples (0h_without ssDNA) were obtained after blood collection without rotating in the closed-loop model. Negative control samples (2h_without ssDNA and 4h_without ssDNA) did not include oligonucleotides but rotated in the closed-loop model.

2013-05-07 | E-GEOD-46676 | biostudies-arrayexpress

ACE-Scan of the ATP DNA aptamer on 10^12 density Gen1 DNA microarray

Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.

2017-12-20 | E-MTAB-6374 | biostudies-arrayexpress

ACE-Scan of the ATP DNA aptamer on various density Gen2 DNA microarrays

2017-12-20 | E-MTAB-6375 | biostudies-arrayexpress

ACE-Scan of the cocaine DNA aptamer on 10^12 Gen1 DNA microarray

2017-12-20 | E-MTAB-6377 | biostudies-arrayexpress

ACE-Scan of the ATP RNA aptamer on 10^12 Gen1 DNA microarray

2017-12-20 | E-MTAB-6376 | biostudies-arrayexpress

ACE-Scan of the thrombin DNA aptamer on 10^10 Gen1 DNA microarrays with sodium and potassium buffers in two colors.

2017-12-20 | E-MTAB-6378 | biostudies-arrayexpress

ACE-Scan of the natural add riboswitch aptamer on 10^10 Gen1 DNA microarrays with varying buffer temperatures and Mg2+ cation concentrations

2017-12-20 | E-MTAB-6380 | biostudies-arrayexpress

Potential capacity of aptamers to trigger immune activation in human blood

Project description:Target specific short single-stranded DNA (ssDNA) molecules, called aptamers, are auspicious ligands for numerous in vivo applications. However, aptamers are synthetic molecules, which might be recognized by the immune cells in vivo and induce an activation of the innate immune system. Thus, immune activation potential of synthetic ssDNA oligonucleotides (ODNs) was determined using a well established closed-loop circulation model. Fresh human blood was incubated at 37°C for 2 or 4 hours with ssDNA ODNs (SB_ODN) or CpG ODN as positive control. Transcriptional changes were determined by microarray analyses. Blood samples containing SB_ODN demonstrated after 4 hours a significant regulation of 295 transcripts. Amongst others, CCL8, CXCL10, CCL7 and CXCL11 were highest regulated genes. Gene Ontology terms and KEGG pathway analyses exhibited that the differentially expressed genes belong to the transcripts that are regulated during an immune and inflammatory response, and were overrepresented in TLR signaling pathway. This study shows for the first time the potential of aptamers to activate immune system after systemic application into the human blood. Thus, we highly recommend performing of these preclinical tests with potential aptamer-based therapeutics.

2013-05-07 | GSE46676 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data