Transcription profiling of islet of Langerhans from diabetic and non-diabetic patients
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Marco Bugliani
PROVIDER: E-MEXP-1878 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Conditioned media from a human embryonic germ cell-derived line called SDEC was found to be supportive of human embryonic stem cell growth in the absence of feeder layers on a simple type I collagen matrix. We performed gene expression studies comparing this line to non-supportive cell lines (WI-38 and Detroit 551) to try to identify gene targets responsible for this phenomenon. We used Affymetrix microarrays to identify genes that are differentially regulated in SDEC vs. non-supportive cell lines. The goal is to determine which genes maybe be contributing to human embryonic stem cell growth in the absence of a mouse fibroblast feeder layer. Experiment Overall Design: Total RNA samples were extracted from SDEC, WI-38, and Detroit 551 (D551) cell lines to compare gene expressions. Three biological replicates of each were analyzed via micorarray. Gene targets were identified by looking for highly differentially regulated genes in SDEC compared to the non-supportive lines. We concentrated on secreted proteins (which could potentially be secreted into the conditioned media) which we identified by functional annotations and literature research.
2009-12-04 | E-GEOD-15400 | biostudies-arrayexpress
Project description:We report a new protein complex with a role in transcription elongation that is formed by Ypr045c (Thp3) and the Csn12 component of the COP9-signalosome. Thp3-Csn12 is recruited to transcribed genes. Their mutations suppress the gene expression defects of mutants of the THO complex involved in mRNP biogenesis and export and show defects in mRNA accumulation. In vivo transcription elongation impairment of thp3M-bM-^HM-^F mutants is shown by reduction of RNAPII recruitment throughout an active gene and in transcript run on analysis performed in G-less systems. This new complex establishes a novel link between transcription and mRNA processing. Tthree repeats of the wild type control and three of the ypr045cM-bM-^HM-^F mutant (BY4741 background).
2011-02-23 | E-GEOD-18994 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Pyrimethanil (PYR) is a world-wide used fungicide approved for use in plant protection products in Agriculture, and with some (eco)toxicological concerns.We aimed at finding molecular biomarkers in the model yeast Saccharomyces cerevisiae that may be used to predict potential cytotoxic effects of this xenobiotic while providing mechanistic clues possibly relevant for experimentally less accessible non-target eukaryotes. We used microarrays to carry out a gene expression profiling analysis in S. cereviseae strain BY4741 upon 2 hours exposure to PYR at concentrations exerting moderate to median levels of phenotypic effects (inhibition of yeast growth rate). Two exposure scenarios were analysed, namely the 20% and 50%-inhibitory concentrations of PYR (IC20 and IC50, respectively), compared to control cells not exposed to the fungicide (CT02). Exponential standardized cell suspensions of S. cerevisiae BY4741 in minimal growth medium were incubated in the presence of 20 and 110 mg/L of PYR (corresponding to the PYR IC20 and IC50, respectively), or in medium non-supplemented with the fungicide (control cells, CT02) during 2 h, and used for total RNA isolation and hybridization on Affymetrix microarrays. Exposure experiments with both concentrations of PYR and with control cells were carried out together. For each exposure condition, independent biological triplicates were processed and analysed.
2014-05-23 | E-GEOD-53126 | biostudies-arrayexpress
Project description:The world-wide used herbicide alachlor is among the priority substances listed in the European Water Framework Directive. We aimed at finding molecular biomarkers in the model yeast Saccharomyces cerevisiae that may be used to predict potential cytotoxic effects of this xenobiotic while providing mechanistic clues possibly relevant for experimentally less accessible non-target eukaryotes. We used microarrays to carry out a gene expression profiling analysis in S. cereviseae strain BY4741 upon 2 hours exposure to alachlor at concentrations exerting slight to moderate levels of phenotypic effects (inhibition of yeast growth rate). Two exposure scenarios were analysed, namely the lowest observed effect concentration (LOEC; ~8% growth inhibition) and the 20%-inhibitory concentration (IC20), compared to control cells not exposed to the herbicide (CT02). Exponential standardized cell suspensions of S. cerevisiae BY4741 in minimal growth medium were incubated in the presence of 110 or 200 mg/L of ALA (corresponding to the LOEC and the IC20, respectively, of alachlor) or in medium non-supplemented with the herbicide (control cells, CT02) during 2 h, and used for total RNA isolation and hybridization on Affymetrix microarrays. Exposure experiments with each concentration of alachlor versus controls were carried out independently. For each exposure condition, independent biological triplicates were processed and analysed.
2011-08-27 | E-GEOD-28677 | biostudies-arrayexpress
Project description:It is still unclear how aerobic exercise training regulates cell cycle in hypertensive heart. This microarray research was intended to pathway analysis exploration about effect of exercise in hypertension heart molecular mechanism. Experiment involved Wistar Kyoto rat which was used as wild type (CON) group and spontaneous hypertensive rat (SHR). SHR was divided into two groups, hypertensive swimming exercise group (HTN-EX) and hypertensive sedentary group (HTN). Microarray hybridization was analyzed using the Affymetrix GeneChip Rat Gene 1.0 ST Array. Arrays were hybridized at 60 rpm and 45°C for 17 hours. Subsequently, arrays were washed using the Affymetrix Fluidics Station 450 and stained with streptavidin-phycoerythrin using the GeneChip® Hybridization, Wash, and Stain Kit (900720). The stained array was then scanned on an Affymetrix GeneChip® Scanner 3000.
2024-07-05 | E-MTAB-13035 | biostudies-arrayexpress
Project description:The SnRK1 protein kinase, the plant ortholog of mammalian AMPK and yeast Snf1, is activated by the energy depletion caused by adverse environmental conditions. Upon activation, SnRK1 triggers extensive transcriptional changes to restore homeostasis and promote stress tolerance and survival partly through the inhibition of anabolism and the activation of catabolism. Despite the identification of a few bZIP transcription factors as downstream effectors, the mechanisms underlying gene regulation, and in particular gene repression by SnRK1, remain mostly unknown. microRNAs (miRNAs) are 20-24nt RNAs that regulate gene expression post-transcriptionally by driving the cleavage and/or translation attenuation of complementary mRNA targets. In addition to the well-established role of miRNAs as regulators of plant development, mounting evidence implicates miRNAs in the response to environmental stress. Given the involvement of miRNAs in stress responses and the fact that some of the SnRK1-regulated genes are miRNA targets, we postulated that miRNAs drive part of the transcriptional reprogramming triggered by SnRK1 activation. To test this we have performed comparative analyses of the transcriptional response to energy deprivation between WT and dcl1-9, a mutant deficient in miRNA biogenesis. To assess the impact of miRNA deficiency on the starvation response we performed transcriptomics analyses of WT and dcl1-9 plants by subjecting leaves to 6h of light (control) or darkness (starvation)
2013-07-15 | E-GEOD-46713 | biostudies-arrayexpress
Project description:The A238L gene has been selectively expressed in mouse T lymphocytes using tissue specific promoter, enhancer and locus control region sequences for CD2. The resulting two independently derived transgenic mice expressed the transgene and developed a metastatic, angiogenic and transplantable CD4+CD8+ CD69- lymphoma. The absence of CD69 from the tumour cells suggests that they were derived from T-cells at a stage prior to positive selection. In contrast, transgenic mice similarly expressing a mutant A238L, mutA238L, solely inhibiting transcription mediated by NF-B, were indistinguishable from wild type mice. Expression of Rag 1, Rag2, TCRbeta V8.2, CD25, FoxP3, Bcl3, Bcl2 l14, Myc, IL-2, NFAT1, Itk, by purified CD4+CD8+ CD69- thymocytes from A238L transgenic mice was consistent with the phenotype. Similarly evaluated expression profiles of CD4+CD8+ CD69- thymocytes from the mutant A238L transgenic mice were comparable to those of wild type mice. Purified CD4+CD8+CD69- thymocytes were prepared for wild-type control FVB/N mice, as well as from the FVB/N transgenic mice expressing the A238L and the mutated A238L, mutA238L. Comparisons were performed between the two transgenic mice lines and the control mice.
2011-12-01 | E-GEOD-34048 | biostudies-arrayexpress
Project description:Mutations of RUNX1 are detected in patients with myelodysplastic syndrome (MDS). In particular, C-terminal truncation mutations lack a transcription regulatory domain and have increased DNA binding through the runt homology domain (RHD). The expression of the RHD, RUNX1(41-214), in mouse hematopoietic cells induced progression to MDS and acute myeloid leukemia (AML). Analysis of pre-myelodysplastic animals revealed expansion of c-Kit+Sca-1+Lin- (KSL) cells and skewed differentiation to myeloid at the expense of the lymphoid lineage. These abnormalities correlate with the phenotype of Runx1-deficient animals, as expected given the reported dominant-negative role of C-terminal mutations over the full-length RUNX1. However, MDS is not observed in Runx1-deficient animals. Gene expression profiling revealed that RUNX1(41-214) KSLs have an overlapping yet distinct gene expression profile from Runx1-deficient animals. Moreover, an unexpected parallel was observed between the hematopoietic phenotype of RUNX1(41-214) and aged animals. Genes deregulated in RUNX1(41-214), but not in Runx1-deficient animals, were inversely correlated with the aging gene signature of hematopoietic stem cells (HSC), suggesting that disruption of the expression of genes related to normal aging by RUNX1 mutations contributes to development of MDS. The data presented here provide insights into the mechanisms of development of MDS in HSCs by C-terminal mutations of RUNX1. Gene expression analysis were performed on c-Kit+/Sca-1+/Lin-/IL7Ra- (KSL) cells sorted from RUNX1(41-214)-expressing and Runx1-knockout (Runx1floxed/floxed MxCre+/-) and control mice (Runx1floxed/floxedMxCre-/-).
2012-11-29 | E-GEOD-40155 | biostudies-arrayexpress
Project description:Despite their different origin and function, both pollen tubes and root hairs share the same sort of apical growth mechanism, i.e., the spatially focused cell expansion at the very apex. Ion fluxes, membrane trafficking, the actin cytoskeleton and their interconnection via signaling networks have been identified as fundamental processes underlying this kind of growth. Several molecules involved in apical growth have been identified, but the genetic basis is far from being fully characterized. We have used Affymetrix Arabidopsis ATH1 GeneChips to obtain the expression profiles of isolated Arabidopsis root hairs. A comparison with the expression profile of flow-sorted pollen grains reveals an overlap in the expression of 4989 genes, which corresponds to 42% of the root hair transcriptome and 76% of the pollen transcriptome, respectively. Our comparison with transcriptional profiles of vegetative tissues by principal component analysis and hierarchical clustering shows a clear separation of these samples comprised of cell types with diffuse growth from the two cell types with apical growth. 277 genes are enriched and 49 selectively expressed, respectively, in root hairs and pollen. From this set of genes emerges an apical growth signature containing novel candidate genes for apical growth determination. Root hairs were isolated from Arabidopsis seedlings and total RNA was isolated for expression profiling on Affymetrix ATH1 arrays. The study was performed with biological duplicates.
2014-08-05 | E-GEOD-38486 | biostudies-arrayexpress