Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcription profiling of Methanosarcina mazei grown with trimethylamine or methanol to investigate the expression pattern of methyltransferase genes

ABSTRACT: The genomic expression patterns of Methansarcina mazei growing with trimethylamine or methanol were measured.

ORGANISM(S): Methanosarcina mazei

SUBMITTER: Uwe Deppenmeier

PROVIDER: E-MEXP-2108 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Transcriptional profiling of methyltransferase genes during growth of Methanosarcina mazei on trimethylamine.

Krätzer Christian C Carini Paul P Hovey Raymond R Deppenmeier Uwe U

Journal of bacteriology 20090612 16

The genomic expression patterns of Methanosarcina mazei growing with trimethylamine were measured in comparison to those of cells grown with methanol. We identified a total of 72 genes with either an increased level (49 genes) or a decreased level (23 genes) of mRNA during growth on trimethylamine with methanol-grown cells as the control. Major differences in transcript levels were observed for the mta, mtb, mtt, and mtm genes, which encode enzymes involved in methane formation from methanol and ...[more]

PMID: 19525341

Similar Datasets

Transcription profiling of Sinorhizobium meliloti strain 1021FDC5 grown in liquid, solid or semi-solid media

Project description:S. meliloti 1021FDC5 was grown at 30ºC in 20 ml of TY broth with shaking to late logarithmic phase (optical density at 600 nm = 1-1.2). After incubation, cells were pelleted, washed twice in MM and resuspended in 2 ml of the latter medium. For time course experiments in liquid, 0.5 ml of the inoculation culture was added to 50 ml of fresh MM. At various times, samples were removed for determining viable cells counts as well as for RNA isolation/preparation (7 and 14 hours). For experiments on plates, 20 ml of MM containing 0.7% (Semisolid) or 1.3% (Solid) agar was dispensed onto each Petri dish and allowed to gel. The plates were air dried at room temperature for 15 min. 0.1 ml of the inoculation culture was plated onto the surface of the plates and allowed to dry for 10 min. The plates were then inverted and incubated at 30ºC.

2009-04-03 | E-MEXP-1953 | biostudies-arrayexpress

siRNA knock-down of MXI1 in human neuroblastoma cells

Project description:SK-N-BE(2)c and SK-N-SH neuroblastoma cells were transfected in triplicates with siRNA against MXI1 or an unspecific control siRNA and grown at hypoxia (1 % O 2) for 24 hours. RNA extracted from each siMXI1 sample was hybridized to the corresponding control siRNA sample in dye-swap duplicates giving a total of 12 hybridizations. After quality data filtering the dye-swap assay pairs were merged by averaging ratios over each array reporter, follow by LOWESS normalization, giving a total of six assays.

2009-12-04 | E-MEXP-2033 | biostudies-arrayexpress

Transcription profiling by array of Zea mays opaque2 mutant, opaque7 mutant and double mutants

Project description:Comparison of maize gene expression in the opaque2, opaque7 and double mutant backgrounds

2011-01-01 | E-MEXP-2862 | biostudies-arrayexpress

Transcription profiling of mouse thymus in pre diabetic and diabetic state of NOD (non obese diabetic) animal strain

Project description:The current project is within the range of molecular immunogenetic auto immune diseases and refers to the comparative study of promiscuous gene expression of tissue-specific antigens (TSAs) in the thymus of NOD mice line (non obese diabetic) who plays the auto-immune diabetes mellitus type 1, during the transition from state pre-diabetics to diabetics. Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Use the technology of oligo arrays to investigate the expression of miRNAs and cDNA microarrays to investigate the expression of genes encoding the messenger RNAs including TSAs (tissue specific antigens). Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, SP, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of Sï¿½o Paulo, Campus of Ribeirï¿½o Preto, Brazil. We studied both pre-diabetic (8ï¿½2 week-old) and diabetic (20ï¿½2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check ï¿½ Active Kit (Roche Diagnï¿½stica Brasil, Sï¿½o Paulo, Brazil). The thymic stroma was separated from the whole thymus, as previously described (Gray et al. 2002). The central idea is to trace signatures of differential gene expression of the thymus at different stages (transition from state pre-diabetics to diabetics) and, using bioinformatics programs, applied to the analysis of data from arrays [Cluster & Tree View (for signatures of expression), SAM (for statistical analysis of the miRNAs and differentially expressed genes from TSAs), GenMiR++ and Cytoscape (to establish networks between miRNAs genes and genes of TSAs)].

2009-10-14 | E-MEXP-2321 | biostudies-arrayexpress

Transcription profiling of Ralstonia eutropha H16 with regard to PHA metabolism

Project description:Detection of genes that are differentially expressed during PHB metabolism.

2010-04-28 | E-MEXP-2440 | biostudies-arrayexpress

Differential gene expression profile may differentiate responders from non-reponders rheumatoid arthritis patients to methotrexate monotherapy and methotrexate plus TNF-blocker combined therapy

Project description:Oligo microarrays were used to access the transcription profiling of the rheumatoid arthritis patients under two different therapeutic approaches, aiming to evaluate if the cDNA microarray study is able to differentiate responders and non-responders to therapies. In the first experiment (MTX therapy) we analyzed 25 patients from which 8 were classified as MTX responders and 17 MTX non-responders. In the second experiment from the 17 MTX non-responder patients, 8 were non-responders and 9 were responders to additional anti-TNF therapy.

2011-12-31 | E-MEXP-3390 | biostudies-arrayexpress

siRNAi profiling of mouse thymus treated with GIM anti-AIRE

Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).

2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress

Transcription profiling of Sinorhizobium meliloti wild type and Hfq ORF deletion strains

Project description:Hfq-dependent transcriptional alterations in the nitrogen-fixing endosymbiont S. meliloti. Comparison: S. meliloti 1021 strain Vs S. meliloti 1021Dhfq (containing a deletion of the hfq ORF).

2010-12-01 | E-MEXP-2501 | biostudies-arrayexpress

Transcription profiling of human Wilms tumor samples to select genes responsible for tumor development, metastasis and progression

Project description:Expression analysis was performed in 77 Wilms tumors in order to select genes responsible for tumor development, metastasis and progression.

2009-02-05 | E-MEXP-221 | biostudies-arrayexpress

Transcription profiling by array of Ralsonia eutropha H16 wild type and glucose-utilizing mutant G+1 cultivated in medium with fructose or glucose

Project description:In order to identify genes which contribute on the uptake of glucose into cells of the mutant R. eutropha G+1, a genome wide transcription analyses was done. Transcripts of strain H16 and the glucose-utilizing mutant R. eutropha G+1, cultivated in mineral salts medium supplemented with either fructose or glucose were compared.

2011-04-01 | E-MEXP-2662 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data