Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

60 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Hypoxic tubular endothelium and EPC MVs

ABSTRACT: Tubular endothelial cells were cultured in hypoxic conditions (1% O2) and treated or not with microvesicles derived from endothelial progenitor cells.
mRNA profiling of hypoxic cells, treated or not with MVs, was analyzed after nromalization with mRNA profiling of normoxic cells.

This experiment was updated on 27th Jan 2011 to correct descriptions.

ORGANISM(S): Homo sapiens

SUBMITTER: Vincenzo Cantaluppi

PROVIDER: E-MEXP-2972 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

glomerular endotelium and EPC MVs

Project description:Glomerular endothelial cells were cultured in normal condition and treated or not with microvesicles derived from endothelial progenitor cells. mRNA profiling of glomerular endothelial cells , treated with MVs, was analyzed after normalization with mRNA profiling of untreated cells.

2012-11-27 | E-MEXP-3762 | biostudies-arrayexpress

Apoptosis in normoxic and hypoxic tubular epithelial cells treated with EPC MVs

Project description:TECs cultured in normoxic conditions, TECs cultured in hypoxic conditions and TECs cultured in hypoxic treated with EPc derived microvesicles

2011-02-04 | E-MEXP-3086 | biostudies-arrayexpress

Huvec angiogenesis in hypoxic condition treated with caffeic acid

Project description:HUVECs were cultured in hypoxic conditions for 24 hours and treated or not with 1uM caffeic acid. Then cells were evaluated for expression of different genes involved in angiogenesis

2013-06-03 | E-MEXP-3908 | biostudies-arrayexpress

Transcription profiling by array of human islet endothelial cells (hIECs) stimulated with or without 50 ug/ml of islet-derived extracellular vesicles for 12 and 24 hours.

Project description:Human islet endothelial cells (hIECs) were stimulated or not with 50 ug/ml of islet-derived EVs for 12 and 24 hours.

2012-08-08 | E-MEXP-3693 | biostudies-arrayexpress

transcriptional profile of islet EVs for diabetes genes

Project description:Identification of transcriptional profile of several genes involved in diabetes in islet-derived extracellular vesicles (Evs). Recently, EVs are identified as a new mechanism in cell-to-cell communication by transfer of protein and genic information (mRNA, microRNA). Their role is under investigation in immunology, stem cell and cancer, but not in islets and diabetes. The aim of this experiment is to identify mRNA transcripts (in particular, mRNA transcripts involved in diabetes pathophysiology) present in islet Evs.

2012-08-02 | E-MEXP-3695 | biostudies-arrayexpress

Real time quantitative PCR analysis of murine macrophages

Project description:Murine macrophages were isolated from the lungs of mice given a pulmonary challenge with C. neoformans strain H99. Mice were either given a protective (H99γ) or a mock (HKCn) immunization prior to C. neoformans H99 challenge, and macrophages were isolated from the lungs of mice 24 hours, 3 days, or 7 days post-challenge using anti-CD11b microbeads according to the Miltenyi cell sorting system. We used SA Biosciences Toll-like Receptor PCR assay panel to quantitate gene expression of signal transduction factors in total RNA isolated from macrophages derived from immunized mice compared to non-immunized. qPCR gene expression profiling. Macrophages from 5 mice per group were pooled and assayed as indicated in the summary. Each experiment was performed 3 times and the resulting Ct values of each group from each experiment averaged prior to data analysis. TIme points were analyzed separately

2012-08-09 | E-GEOD-39990 | biostudies-arrayexpress

siRNAi profiling of mouse thymus treated with GIM anti-AIRE

Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).

2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress

Real-time quantitative PCR analysis of gene expression in the cerebellum of MeCP2 A140V mutant mice

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2015-02-01 | E-GEOD-35694 | biostudies-arrayexpress

Tiling path analysis of Drosophila Schneider 2 cultured cells to map forum domains

Project description:Forum domains are stretches of chromosomal DNA that are excised from eukaryotic chromosomes during their spontaneous non-random fragmentation. Mostly forum domains are of 50-200 kb in length, although larger domains, up to 500 - 700 kb, are also observed. We performed a genome-wide mapping of forum domains termini in Drosophila Schneider 2 cultured cells using Drosophila melanogaster genomic tiling microarray consisting of overlapping 3 kb fragments. We found that forum domains contain clusters of several or many genes inside. The largest forum domains correspond to the coordinately expressed main clusters of homeotic genes inside BX-C and ANTP-C, cluster of histone genes and clusters of piRNAs. PRE/TRE and binding sites of transcription factors are often reside inside domains, and do not overlap with forum domains termini. The terminal regions of domains often correspond to chromosomal sites containing different classes of mobile elements, binding sites of SuUR protein and regions of intercalary heterochromatin. Our results indicate that forum domains correspond to big multi-gene chromosomal units some of which could be co-coordinately activated or repressed.

2010-11-01 | E-MEXP-2468 | biostudies-arrayexpress

Real-time quantitative PCR analysis of gene expression in the cortex of MeCP2 A140V mutant mice

Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series

2015-02-01 | E-GEOD-35773 | biostudies-arrayexpress