Transcriptomic analysis of tomato plants infected by the geminivirus TYLCSV
Ontology highlight
ABSTRACT:
ORGANISM(S): Lycopersicon esculentum
SUBMITTER: Laura Miozzi
PROVIDER: E-MEXP-3953 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:Agilent 4x44k tobacco micro array of wild type tobacco (WT) and whole tobacco mosaic virus (TMV) containing transgenic tobacco plants. The transgenic plants before resistance break (BRB-6 weeks), after resistance break (ARB-8 weeks) and wild type tobacco plants infected with TMV (TMVi-9weeks) leaves were analyzed. Three biological replicates were performed for each sample.
2014-11-03 | E-MEXP-3934 | biostudies-arrayexpress
Project description:We introduced the GAME1i construct into the indeterminate M82 cultivar by crossing, obtaining plants that displayed a phenotype of severe growth retardation, deformed leaves and abortion of flower buds . In addition, leaves of these plants exhibited dark necrotic spots resembling symptoms typically seen after infection of tomato by pathogenic bacteria like Xanthamonas campestris pv. vesicatoria (Xcv) or Pseudomonas syringae pv. tomato (Pst) . As no other tomato lines grown in the same greenhouse at the same time showed similar disease-like symptoms, we hypothesized that silencing GAME1 might mimic induction of disease symptoms in the absence of a pathogen. Indeed, we were able to isolate neither Xcv nor Pst (or other putative pathogens) from GAME1i leaves that displayed necrotic spots. Microarray analysis was performed to examine if the transgene, and possibly, the corresponding changes in the metabolic profile, induced the plant response system at the transcriptional level.
2011-11-28 | E-MEXP-3455 | biostudies-arrayexpress
Project description:In order to study possible effects of cryptochrome 2-mediated light signals on the global expression profiles of tomato genes, we performed large scale transcription comparisons in wt and CRY2-OX by using a DNA microarray of more than 90,000 tomato oligo-probes.<br>Tomato plants were grown under a daily light cycle of 16h light/8h darkness (LD) and leaves from both genotypes were sampled at presumptive dawn (Zeitgeber time (ZT) 0), eight hours after dawn (ZT8), at presumptive dusk (ZT16) and four hours after dusk (ZT20).
2011-12-12 | E-MEXP-2278 | biostudies-arrayexpress
Project description:A comparative study to determine the pepper leaf curl virus resistance machanism between resistant and susceptible genotypes at three leaf stage. To study the molecular mechanism of pepper leaf curl virus (PepLCV) resistance, pepper plants were exposed to PepLCV through artificial inoculation and hybridization on Agilent tomato microarrays. The expression analysis of PepLCV resistant and susceptible genotypes after artificial inoculation at three leaf stage showed that the resistance against PepLCV is due to sum of expression of hundreds of genes at a particular stage. Tomato microarrays consisting of 43,803 probes were used for whole genome expression analysis of chilli peppers for resistance against PepLCV. Transcripts from the leaves of resistant (BS-35) and susceptible plants (IVPBC-535) were compared in response to PepLCV inoculation at three leaf stage.
2012-10-11 | E-GEOD-41131 | biostudies-arrayexpress
Project description:Gene expression of Condine wild type tomato seedling aerial parts grown on MS medium was compared with that of alpha-dioxygenase2 Divaricata (div) mutant
2009-09-25 | E-MEXP-2265 | biostudies-arrayexpress
Project description:Total RNA was isolated with RNAiso regent (Takara) from 12-day-old seedlings of the areb1 areb2 abf3 triple mutant and WT plants grown on GM agar plates.
2010-07-05 | E-MEXP-2295 | biostudies-arrayexpress
Project description:Total RNA was isolated with RNAiso regent (Takara) from 12-day-old seedlings of the areb1 areb2 abf3 triple mutant and WT plants grown on GM agar plates with or without 50 µM ABA for 6 h.
2009-12-17 | E-MEXP-2187 | biostudies-arrayexpress
Project description:Pooled KRC (LSL-KrasG12D; Rb1L/L; Pdx1-Cre: oncogenic Kras and deleted Rb1 in the pancreas) cells derived from 2 month old mice were compared to pooled KC (LSL-KrasG12D; Pdx1-Cre: oncogenic Kras in the pancreas) cells derived from 8 month old mice.
2014-02-09 | E-MEXP-3988 | biostudies-arrayexpress
Project description:Transcription profiling of carpel development in tomato strains RP75/59 and UC82. Samples: fruit 3 days post anthesis, carpel of flower anthesis, carpel of flower bud to pre-anthesis ( petals length between 7.5 and 9mm), Carpel of flower bud (petals length between 4.5 and 7 mm). Control plants and plants in which flowers were emasculated two days before anthesis were studied.
2009-05-29 | E-MEXP-1643 | biostudies-arrayexpress