Nanopore RNA-seq of human osteosarcoma cell line U2OS treated with siRNA against MDC1, PLRG1, or control siRNA with or without pladienolide B
Ontology highlight
ABSTRACT:
INSTRUMENT(S): MinION
ORGANISM(S): Homo sapiens
SUBMITTER: Sebastian Munk
PROVIDER: E-MTAB-12497 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Investigation of transcriptome changes in four human cell lines (BJ, BJ-5ta, U2OS and HeLa) after treatment for 24 hours with nicotinamide adenine dinucleotide (NAD+). Cells were untreated as the control condition. Nanopore sequencing of cDNA was performed after library preparation with the ONT SQK-PCB109 kit.
2023-09-20 | E-MTAB-13187 | biostudies-arrayexpress
Project description:Sequencing was performed to assess the ability of Nanopore direct cDNA and native RNA sequencing to characterise human transcriptomes. Total RNA was extracted from either HAP1 or HEK293 cells, and the polyA+ fraction isolated using oligodT dynabeads. Libraries were prepared using Oxford Nanopore Technologies (ONT) kits according to manufacturers instructions. Samples were then sequenced on ONT R9.4 flow cells to generate fast5 raw reads in the ONT MinKNOW software. Fast5 reads were then base-called using the ONT Albacore software to generate Fastq reads.
2019-03-14 | E-MTAB-7778 | biostudies-arrayexpress
Project description:In this study, based on Nanopore direct RNA-seq where native RNAs are sequenced directly as near full-length transcripts in the 3' to 5' direction, transcription units of the phytopathogen Dickeya dadantii 3937 were validated and transcriptional termination sites were determined. Briefly, D. dadantii cultures were grown in M63 medium supplemented with 0.2% glucose and 0.2% PGA, until the early exponential phase (A600nm = 0.2, condition 1), or the early stationary phase (A600nm = 1.8, condition 2). RNAs were extracted using a frozen acid-phenol method, as previously described (Hommais et al. 2008), and treated successively with Roche and Biolabs DNases. Two samples were prepared: 50 µg of RNAs from each condition were pulled into one sample (sample 1), whereas the other one contained 100 µg of RNAs from condition 2 (sample 2). Both samples were then supplied to Vertis Biotechnologie AG for Nanopore native RNA-seq: total RNA preparations were first examined by capillary electrophoresis. For sample 1, ribosomal RNA molecules were depleted using an in-house developed protocol (recovery rate = 84%), whereas no ribodepletion was performed for sample 2. 3' ends of RNA were then poly(A)-tailed using poly(A) polymerase, and the Direct RNA sequencing kit (SQK-RNA002) was used to prepare the library for 1D sequencing on the Oxford Nanopore sequencing device. The direct RNA libraries were sequenced on a MinION device (MIN-101B) using standard settings. Basecalling of the fast5 files was performed using Guppy (version 3.6.1) with the following settings: --flowcell FLO-MIN106 --kit SQK-RNA002 --cpu_threads_per_caller 12--compress_fastq --reverse_sequence true --trim_strategy rna. Reads smaller than 50 nt were removed. 466 393 and 556 850 reads were generated for sample 1 and 2, respectively.
2022-01-01 | E-MTAB-10482 | biostudies-arrayexpress
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Purpose: The aim of this study is to compare the transcriptome profiles using a mixture design that allows the relative changes of the majority of the genes profiled to be estimated. Methods - Cell Culture: Lung adenocarcinoma cell lines NCI-H1975 and HCC827 were grown in Roswell Park Memorial Institute (RPMI) 1640 medium with 10% fetal calf serum and 1% penicillin-streptomycin. Methods - RNA preparation: mRNA was extracted using a Qiagen RNA miniprep kit and purified using the NEBNext® Poly(A) mRNA Magnetic Isolation Module (E7490). Purified mRNA spiked with sequins was used for the cRNA-PCR Barcoding (SQK-PCS109 with SQK-PBK004) kit (ONT). Completed libraries were sequenced on PromethION (ONT). Reads were mapped to known genomic features of the GrCh38 reference transcriptome and RNA sequin transcriptome combined sequences at the transcript-level and single reads were then summarized into transcript-level counts using salmon software (Patro et al. 2017).
2023-07-14 | GSE227000 | GEO
Project description:Genomic DNA from 55 wild type Col x Ler F2 individuals was extracted using the CTAB method. Equal amounts of DNA from these 55 plants were pooled into two groups (pool 1 = 4 plants; pool 2 = 51 plants), and nine micrograms of gDNA from each pool was used to generate Nanopore sequencing libraries with the Ligation Sequencing Kit V14 (Nanopore, SQK-LSK114). The libraries were sequenced independently using PromethION (BGI, Hong Kong).
2024-09-02 | E-MTAB-14367 | biostudies-arrayexpress
Project description:Expression profiling was done of FOXK2 depletion by siRNA transfection. This was done on the human osteosarcoma U2OS cell line (which stably expresses FOXK2).
2011-11-03 | E-MEXP-3106 | biostudies-arrayexpress
Project description:Different from canonical ubiquitin-like proteins, Hub1 does not form covalent conjugates with substrates but binds proteins non-covalently. In Saccharomyces cerevisiae, Hub1 associates with spliceosomes and mediates alternative splicing of SRC1, without affecting pre-mRNA splicing generally. Human Hub1 is highly similar to its yeast homolog, but its cellular function remains largely unexplored. Here, we show that human Hub1 binds to the spliceosomal protein Snu66 as in yeast, however, unlike its S. cerevisiae homolog, human Hub1 is essential for viability. Prolonged in vivo depletion of human Hub1 leads to various cellular defects, including splicing speckle abnormalities, partial nuclear retention of mRNAs, mitotic catastrophe and consequently cell death by apoptosis. Early consequences of Hub1 depletion are severe splicing defects, however, only for specific splice sites leading to exon skipping and intron retention. Thus, the ubiquitin-like protein Hub1 is not a canonical spliceosomal factor needed generally for splicing, but rather a modulator of spliceosome performance and facilitator of alternative splicing. Human U2OS cells were transfected with siRNAs to specifically knockdown the ubiquitn-like protein Hub1. Cells treated with non-targeting oligos (GL2) served as negative control. Total RNAs of three biological replicates of each knockdown experiment were isolated and changes of splicing patterns were subsequently analyzed by Affymetrix GeneChip Human Exon 1.0 ST arrays
2014-05-30 | E-GEOD-56878 | biostudies-arrayexpress
Project description:Purpose: The aim of this study is to compare different long-read sequencing platforms using reference lung adenocarcinoma cell lines and spike-in controls. Methods - Cell Culture: Lung adenocarcinoma cell lines NCI-H1975 and HCC827 from a range of passages (2-4) were grown on 3 separate occasions in Roswell Park Memorial Institute (RPMI) 1640 medium with 10% fetal calf serum and 1% penicillin-streptomycin. Methods - RNA preparation: mRNA was extracted using a Qiagen RNA miniprep kit and purified using the NEBNext® Poly(A) mRNA Magnetic Isolation Module (E7490). Purified mRNA spiked with sequins was used for Next Generation Sequencing library preparation using the NEBNext Ultra II Directional RNA Library Prep Kit (Illumina) and the cRNA-PCR Barcoding (SQK-PCS109 with SQK-PBK004) kit (ONT). Completed libraries were sequenced on NextSeq 500 (Illumina) and PromethION (ONT). Iso-Seq libraries were prepared and sequenced by Novogene on Sequel II (PacBio). Reads were mapped to known genomic features of the GRCH38 reference genome and RNA sequin decoy chromosome combined sequences at the gene-level and single reads were then summarized into gene-level counts using featureCounts software (Liao et al. 2014).
2022-07-20 | GSE172421 | GEO
Project description:Expression profiling was done of exposure to phorbol myristate acetate -PMA and FOXK2 depletion by siRNA transfection. This was done on the human osteosarcoma U2OS cell line which stably expresses FOXK2. PMA is an inducer of AP1 activity.
2011-11-03 | E-MEXP-3107 | biostudies-arrayexpress