Identifying crossover locations in an Arabidopsis thaliana Col x Ler F2 population using Nanopore-seq and COmapper
Ontology highlight
ABSTRACT:
INSTRUMENT(S): PromethION
ORGANISM(S): Arabidopsis thaliana
SUBMITTER: Kyuha Choi
PROVIDER: E-MTAB-14367 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We sequenced DNA from a bulk of Col x Ler F2 hybrid plants (WT and recq4) using Nanopore long-read sequencing and identified crossover sites with COmapper. For nanopore sequencing of gDNA from 1,000 pooled seedlings, 10-day-old seedlings were ground in liquid nitrogen using a mortar and pestle. The ground tissue was resuspended in four volumes of CTAB buffer (1% [w/v] CTAB, 50 mM Tris-HCl pH 8.0, 0.7 M NaCl, 10 mM EDTA) and incubated at 65°C for 30 min. Following chloroform extraction, isopropanol precipitation and removal of RNAs as above, the gDNA pellet was resuspended in 150 μl TE (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA) buffer and gDNA was quantified using a Qubit dsDNA Broad Range assay kit (Thermo Fisher, Q32853). Nine micrograms of gDNA from pollen or seedlings was used to construct a nanopore long-read sequencing library using a Ligation Sequencing Kit V14 (Nanopore, SQK-LSK114). The libraries were sequenced using a PromethION platform (BGI, Hong Kong).
2024-08-19 | E-MTAB-14368 | biostudies-arrayexpress
Project description:We sequenced DNA from the leaves of ten Col x Ler F1 hybrid plants (WT and recq4) using Nanopore long-read sequencing and identified crossover sites with COmapper. These data were used as a negative control for COmapper, as no crossover sites were expected to be detected. For nanopore sequencing of gDNA from leaves, leaves from 10 5-week-old plants were ground in liquid nitrogen using a mortar and pestle. The ground tissue was resuspended in four volumes of CTAB buffer (1% [w/v] CTAB, 50 mM Tris-HCl pH 8.0, 0.7 M NaCl, 10 mM EDTA) and incubated at 65°C for 30 min. Following chloroform extraction, isopropanol precipitation and removal of RNAs as above, the gDNA pellet was resuspended in 150 μl TE (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA) buffer and gDNA was quantified using a Qubit dsDNA Broad Range assay kit (Thermo Fisher, Q32853). Nine micrograms of gDNA from pollen or seedlings was used to construct a nanopore long-read sequencing library using a Ligation Sequencing Kit V14 (Nanopore, SQK-LSK114). The libraries were sequenced using a PromethION platform (BGI, Hong Kong).
2024-08-19 | E-MTAB-14381 | biostudies-arrayexpress
Project description:We sequenced pollen DNA from Col x Ler F1 hybrid plants using Nanopore long-read sequencing and identified crossover sites with COmapper. To purify pollen grains from F1 hybrid plants and extract their genomic DNA, whole inflorescences of hybrid plants were collected and transferred to ice-cold 10% (w/v) sucrose in a 50-ml tubes. Flowers were homogenized with a blender (Tefal, BL3051KR), filtered through 80-μm nylon mesh, and centrifuged at 350g for 10 min at 4 °C. The supernatant was discarded and the pellet was resuspended in 10% (w/v) sucrose, filtered through a 40-μm cell strainer, and centrifuged at 100g for 10 min at 4°C. The purified pellet was frozen in liquid nitrogen and ground with a mortar and pestle. The pellet powder was resuspended in CTAB buffer (1% [w/v] CTAB, 50 mM Tris-HCl pH 8.0, 0.7 M NaCl, 10 mM EDTA). Proteinase K (NEB, P8107S) and RNase A (20 mg/ml, Roche, 10109142001) were added to a final concentration of 80 U/ml and 20 μg/ml, respectively. To check pollen disruption, a 1-μl sample was diluted in a 1:10 ratio with 10% (w/v) sucrose and observed under a stereomicroscope (Leica, M165 FC). Then, 500 μl of the resuspended pellet was transferred to a 1.5-ml tube, to which an equal volume of 25:24:1 (v/v/v) phenol:chloroform:isoamylalcohol (Sigma, 77617) was added, and the mixture was homogenized by gentle manual shaking. The tube was centrifuged at 15,000g for 10 min at 4°C, and 400 μl of supernatant was transferred into a new tube, to which a Nanobind disk (Nanobind® Plant Nuclei Kit RT, PacBio, 102-302-000) was added. The tube containing the Nanobind disk was gently mixed, 400 μl isopropanol was added, and the tube was slowly inverted and incubated for 2 h at room temperature on a rotator set at 7 rpm. A magnetic rack (DynaMagTM-2, Invitrogen, 12321D) was used to separate the disk and the supernatant, and the supernatant was removed. PW1 buffer in the Nanobind Plant Nuclei Kit was used for washing the disk twice and the supernatant was removed completely by centrifugation. Then, 150 μl EB+ buffer was added onto the disc and gently tabbed and incubated overnight at room temperature. The supernatant was transferred to a new 1.5-ml tube and stored at −20°C. The DNA was quantified using a Qubit dsDNA Broad Range assay kit (Thermo Fisher, Q32853) and integrity checked by gel electrophoresis. Nine micrograms of gDNA from pollen was used to construct a nanopore long-read sequencing library using a Ligation Sequencing Kit V14 (Nanopore, SQK-LSK114). The libraries were sequenced using a PromethION platform (BGI, Hong Kong).
2024-08-19 | E-MTAB-14369 | biostudies-arrayexpress
Project description:This repository contains whole genome long read sequencing data generated using Oxford Nanopore Technologies from a mouse of the Four Core Genotypes cross. By crossing mice with both a deletion of the sex-determining factor Sry on the Y-chromosome and a transgenic insertion of Sry on Chromosome 3, four combinations of gonadal (testis or ovaries) and chromosomal (XX or XY) are generated, namely XYSry-Chr3Sry+ (gonadal and chromosomal males), XYSry- (gonadal females, chromosomal males), XX (gonadal and chromosomal females), XXChr3Sry+ (gonadal males, chromosomal females). The transgenes were on a C57BL6 genetic background which is crossed with a CAST/EiJ female to allow for the distinction of the parental haplotypes. DNA sequencing was done on a liver sample of the XYSry+ genotype.
2024-10-14 | E-MTAB-14291 | biostudies-arrayexpress
Project description:The purpose was to investigate transcript and splicing changes in U2OS cells following siRNA-mediated depletion of MDC1 and PLRG1 or treatment with the splicing inhibitor pladienolide B. Cells were treated with control siRNA as control condition. Nanopore sequencing of cDNA was performed after library preparation with ONT kits SQK-PCS109 and SQK-PBK004.
2023-01-11 | E-MTAB-12497 | biostudies-arrayexpress
Project description:Investigation of transcriptome changes in four human cell lines (BJ, BJ-5ta, U2OS and HeLa) after treatment for 24 hours with nicotinamide adenine dinucleotide (NAD+). Cells were untreated as the control condition. Nanopore sequencing of cDNA was performed after library preparation with the ONT SQK-PCB109 kit.
2023-09-20 | E-MTAB-13187 | biostudies-arrayexpress
Project description:In this study, based on Nanopore direct RNA-seq where native RNAs are sequenced directly as near full-length transcripts in the 3' to 5' direction, transcription units of the phytopathogen Dickeya dadantii 3937 were validated and transcriptional termination sites were determined. Briefly, D. dadantii cultures were grown in M63 medium supplemented with 0.2% glucose and 0.2% PGA, until the early exponential phase (A600nm = 0.2, condition 1), or the early stationary phase (A600nm = 1.8, condition 2). RNAs were extracted using a frozen acid-phenol method, as previously described (Hommais et al. 2008), and treated successively with Roche and Biolabs DNases. Two samples were prepared: 50 µg of RNAs from each condition were pulled into one sample (sample 1), whereas the other one contained 100 µg of RNAs from condition 2 (sample 2). Both samples were then supplied to Vertis Biotechnologie AG for Nanopore native RNA-seq: total RNA preparations were first examined by capillary electrophoresis. For sample 1, ribosomal RNA molecules were depleted using an in-house developed protocol (recovery rate = 84%), whereas no ribodepletion was performed for sample 2. 3' ends of RNA were then poly(A)-tailed using poly(A) polymerase, and the Direct RNA sequencing kit (SQK-RNA002) was used to prepare the library for 1D sequencing on the Oxford Nanopore sequencing device. The direct RNA libraries were sequenced on a MinION device (MIN-101B) using standard settings. Basecalling of the fast5 files was performed using Guppy (version 3.6.1) with the following settings: --flowcell FLO-MIN106 --kit SQK-RNA002 --cpu_threads_per_caller 12--compress_fastq --reverse_sequence true --trim_strategy rna. Reads smaller than 50 nt were removed. 466 393 and 556 850 reads were generated for sample 1 and 2, respectively.
2022-01-01 | E-MTAB-10482 | biostudies-arrayexpress
Project description:Using long-read nanopore sequencing, we obtained chromosome-wide phased methylomes of the active and inactive X in mouse placenta and neural stem cells (NSCs), overcoming the limitations if short-read bisulfite sequencing in allelic resolution. We also conducted quantitative analysis of methylation properties like symmetry and entropy, providing a more comprehensive view of epigenetic silencing in X chromosome inactivation. We also resolved the allele-specific genetics and epigenetics of structural macrosatellite Dxz4 and other repeats.
2024-03-12 | E-MTAB-13706 | biostudies-arrayexpress
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Genomic DNA from 55 Col x Ler F2 individuals was extracted using CTAB and used to generate sequencing libraries as described (Rowan et al; Yelina et al), with the following modifications. DNA was extracted from 3 rosette leaves of 5 week old plants and 150 ng of DNA used as input for each library. DNA shearing was carried out for 20 minutes at 37°C with 0.4U of DNA Shearase (Zymo research). The barcoded adapters used for library construction are listed in Rowan et al. Each set of 96 libraries was sequenced on one lane of an Illumina NextSeq500 instrument (300-cycle Mid Output run). Sequencing data was analysed to identify crossovers as previously reported, using the TIGER pipeline. The same gDNA was pooled into two groups (pool1 = F2_1 to F2_4; pool2 = F2_5 to F2_55) and sequenced with Nanopore PromethION, which is available at E-MTAB-14367
2024-08-19 | E-MTAB-14380 | biostudies-arrayexpress