Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Whole-chromosome methylation patterns of the mouse inactive X

ABSTRACT: Using long-read nanopore sequencing, we obtained chromosome-wide phased methylomes of the active and inactive X in mouse placenta and neural stem cells (NSCs), overcoming the limitations if short-read bisulfite sequencing in allelic resolution. We also conducted quantitative analysis of methylation properties like symmetry and entropy, providing a more comprehensive view of epigenetic silencing in X chromosome inactivation. We also resolved the allele-specific genetics and epigenetics of structural macrosatellite Dxz4 and other repeats.

INSTRUMENT(S): PromethION

ORGANISM(S): Mus musculus

SUBMITTER: Mei Du

PROVIDER: E-MTAB-13706 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Similar Datasets

Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.

Project description:The naked mole-rat (NMR; Heterocephalus glaber) has recently gained considerable attention in the scientific community for its unique potential to unveil novel insights in the fields of medicine, biochemistry, and evolution. NMRs exhibit unique adaptations that include protracted fertility, cancer resistance, eusociality, and anoxia. This suite of adaptations is not found in other rodent species, suggesting that interrogating conserved and accelerated regions in the NMR genome will find regions of the NMR genome fundamental to their unique adaptations. However, the current NMR genome assembly has limits that make studying structural variations, heterozygosity, and non-coding adaptations challenging. We present a complete diploid naked-mole rat genome assembly by integrating long-read and 10X-linked read genome sequencing of a male NMR and its parents, and Hi-C sequencing in the NMR hypothalamus (N=2). Reads were identified as maternal, paternal or ambiguous (TrioCanu). We then polished genomes with Flye, Racon and Medaka. Assemblies were then scaffolded using the following tools in order: Scaff10X, Salsa2, 3d-DNA, Minimap2-alignment between assemblies, and the Juicebox Assembly Tools. We then subjected the assemblies to another round of polishing, including short-read polishing with Freebayes. We assembled the NMR mitochondrial genome with mitoVGP. Y chromosome contigs were identified by aligning male and female 10X linked reads to the paternal genome and finding male-biased contigs not present in the maternal genome. Contigs were assembled with publicly available male NMR Fibroblast Hi-C-seq data (SRR820318). Both assemblies have their sex chromosome haplotypes merged so that both assemblies have a high-quality X and Y chromosome. Finally, assemblies were evaluated with Quast, BUSCO, and Merqury, which all reported the base-pair quality and contiguity of both assemblies as high-quality. The assembly will next be annotated by Ensembl using public RNA-seq data from multiple tissues (SRP061363). Together, this assembly will provide a high-quality resource to the NMR and comparative genomics communities.

Project description:During interphase, the inactive X chromosome (Xi) adopts an unusual 3D configuration known as the Barr body and is largely transcriptionally silent. Despite the importance of X inactivation, little is known about the 3D configuration of Xi and its relationship to gene silencing. We recently showed that in humans, Xi exhibits two distinctive structural features. First, Xi is partitioned into two huge intervals, called superdomains, such that pairs of loci in each superdomain show an enhanced contact frequency with one another. The boundary between the two superdomains lies near DXZ4, a macrosatellite repeat spanning ~300kb, whose Xi allele extensively binds the protein CTCF. Second, Xi exhibits extremely large loops, up to 77Mb long, called superloops. DXZ4 lies at the anchor of several superloops. Here, we use 3D mapping to study the structure of Xi, focusing on the role of DXZ4. We show that superloops and superdomains are conserved across mammals. We develop a novel variant of our in situ Hi-C protocol, dubbed COLA (COncatemer Ligation Assay) to probe the higher order structures formed by the superloops. In COLA, in situ proximity ligation of multiple extremely short fragments produced by the enzyme CviJI is used to efficiently map simultaneous proximity among three or more loci. Using data from Hi-C and COLA, we demonstrate that DXZ4 and other superloop anchors tend to co-locate simultaneously within the same cells, a result that is confirmed by 3D-FISH. Finally, we examine the effects of deleting DXZ4 from Xi in human cells. Using in situ Hi-C, microscopy, and RNA-FISH, we show that superdomains and superloops disappear; that Xi frequently dissociates into multiple separate structures; and that transcriptional silencing on Xi is compromised. Deletion of DXZ4 from the active X chromosome (Xa) has no such effect. Thus, DXZ4 is essential for proper folding and silencing of Xi. Hi-C protocol was used on wildtype and DXZ4-deleted cells to examine the structure of Xi. A novel variant of our in situ Hi-C protocol, dubbed COLA (COncatemer Ligation Assay), was developed to probe the higher order structures formed by the superloops. This series also includes RNA-seq data on Retinal Pigmented Epithelial Cells (hTERT-RPE1). At the time of submission, processed data were available only for the RNA-seq samples. Submitter states that processed data files for HiC samples will be added to this series in the future.

Dataset Information

Whole-chromosome methylation patterns of the mouse inactive X

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets